Incidental Mutation 'R8088:Pnldc1'
ID629811
Institutional Source Beutler Lab
Gene Symbol Pnldc1
Ensembl Gene ENSMUSG00000073460
Gene Namepoly(A)-specific ribonuclease (PARN)-like domain containing 1
SynonymsLOC240023
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8088 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12888902-12910000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12897302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000129377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163394]
Predicted Effect probably damaging
Transcript: ENSMUST00000163394
AA Change: D271G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129377
Gene: ENSMUSG00000073460
AA Change: D271G

DomainStartEndE-ValueType
Pfam:CAF1 3 373 1e-75 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,318 M453V probably benign Het
Atp2c1 A T 9: 105,452,569 probably null Het
Ccdc134 T A 15: 82,131,789 probably benign Het
Ccdc162 G T 10: 41,623,414 H1066Q possibly damaging Het
Ccna1 A G 3: 55,051,071 S64P probably benign Het
Defb12 T C 8: 19,112,821 probably null Het
Dhx9 C A 1: 153,462,697 V738L probably benign Het
Dnah10 A G 5: 124,754,266 N843S probably benign Het
Dspp A G 5: 104,177,256 D495G unknown Het
Dus2 A G 8: 106,030,441 M88V probably benign Het
Dusp13 A G 14: 21,741,237 V49A probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Entpd3 A C 9: 120,554,173 R91S probably benign Het
Fam207a T C 10: 77,514,395 N53S probably benign Het
Fam83c C A 2: 155,831,639 V210F probably damaging Het
Flot1 G A 17: 35,829,978 A287T probably damaging Het
Gm11639 A T 11: 104,998,246 I4163L probably benign Het
Gm19410 A G 8: 35,806,841 K1412E probably benign Het
Gsn G A 2: 35,292,647 V241M possibly damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Heatr5a T C 12: 51,947,996 D451G possibly damaging Het
Hmcn2 G A 2: 31,426,903 W3831* probably null Het
Il3 A G 11: 54,265,549 V119A probably benign Het
Jam3 T C 9: 27,098,860 K276R probably benign Het
Kcnt1 G A 2: 25,894,314 G277D possibly damaging Het
Kif28 T A 1: 179,700,354 D744V probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Loxhd1 T C 18: 77,342,013 I535T possibly damaging Het
Lzts1 A C 8: 69,135,822 L494R probably benign Het
Mettl4 A G 17: 94,735,367 V347A probably damaging Het
Mff A G 1: 82,751,649 E270G probably damaging Het
Mroh2b A T 15: 4,900,503 I24F possibly damaging Het
Muc16 A T 9: 18,519,300 Y8102* probably null Het
Myh14 A T 7: 44,665,496 M1K probably null Het
Myo18b T A 5: 112,879,510 probably benign Het
Neurl1a C A 19: 47,257,434 P502T probably damaging Het
Nrp1 G A 8: 128,468,516 W484* probably null Het
Olfr131 T A 17: 38,082,561 H139L possibly damaging Het
Olfr1317 T A 2: 112,142,257 I104N probably benign Het
Pcdhac1 T C 18: 37,091,754 V540A possibly damaging Het
Pcdhga9 A G 18: 37,736,954 probably benign Het
Pm20d1 A C 1: 131,801,763 N176T probably benign Het
Pold3 A G 7: 100,112,301 V63A probably damaging Het
Rbm18 A C 2: 36,127,184 S61A probably benign Het
Rdh14 T C 12: 10,394,551 L134P probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rtel1 A G 2: 181,322,345 T46A probably damaging Het
Rtn3 T C 19: 7,434,998 I823V probably damaging Het
S1pr1 A G 3: 115,712,034 S304P probably damaging Het
Scfd2 A G 5: 74,531,363 V86A probably benign Het
Scgb1a1 C T 19: 9,085,235 V66M probably damaging Het
Sec31a A T 5: 100,378,862 M46K Het
Sgsm1 A G 5: 113,255,268 M971T probably damaging Het
Slc5a11 T C 7: 123,265,728 I419T probably benign Het
Slco6d1 A T 1: 98,466,706 T372S possibly damaging Het
Spata31 T A 13: 64,920,865 Y276N probably benign Het
Sprr2k C T 3: 92,433,489 R49W unknown Het
Sspo G A 6: 48,457,613 C1013Y probably damaging Het
Ssr2 A G 3: 88,579,883 R2G possibly damaging Het
St18 C A 1: 6,828,005 T677K probably benign Het
Thap11 A T 8: 105,855,895 I179F probably damaging Het
Trf C A 9: 103,211,931 G586C probably damaging Het
Umodl1 A G 17: 30,973,796 N299S probably benign Het
Xrcc5 C A 1: 72,312,436 A55E probably damaging Het
Other mutations in Pnldc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pnldc1 APN 17 12905758 splice site probably benign
IGL01599:Pnldc1 APN 17 12906528 missense probably benign 0.18
IGL02109:Pnldc1 APN 17 12905538 missense probably benign 0.01
R0022:Pnldc1 UTSW 17 12890119 missense probably damaging 1.00
R0423:Pnldc1 UTSW 17 12890076 missense possibly damaging 0.51
R1921:Pnldc1 UTSW 17 12888928 missense possibly damaging 0.94
R1978:Pnldc1 UTSW 17 12906505 missense possibly damaging 0.88
R2403:Pnldc1 UTSW 17 12899890 missense probably damaging 1.00
R4027:Pnldc1 UTSW 17 12890779 missense probably benign 0.01
R4574:Pnldc1 UTSW 17 12892782 missense probably benign 0.01
R5148:Pnldc1 UTSW 17 12892789 missense probably benign 0.00
R5381:Pnldc1 UTSW 17 12890396 missense probably benign 0.07
R5973:Pnldc1 UTSW 17 12894373 missense probably benign 0.07
R6073:Pnldc1 UTSW 17 12890363 missense probably null 0.05
R6368:Pnldc1 UTSW 17 12905864 missense probably damaging 1.00
R6551:Pnldc1 UTSW 17 12905569 missense probably damaging 0.98
R7909:Pnldc1 UTSW 17 12903211 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGGGCCAGTCACAGGAGG -3'
(R):5'- TGTGTGGGAGCTGAAAGACACT -3'

Sequencing Primer
(F):5'- GAGGTTATGTAATCAGATTCAGGCTC -3'
(R):5'- CACTGCCCTAATGTGATTGGACAG -3'
Posted On2020-06-30