Incidental Mutation 'R8088:Umodl1'
ID629812
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8088 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30973796 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 299 (N299S)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably benign
Transcript: ENSMUST00000066554
AA Change: N299S

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: N299S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066981
AA Change: N299S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: N299S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114555
AA Change: N299S

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: N299S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,318 M453V probably benign Het
Ccdc162 G T 10: 41,623,414 H1066Q possibly damaging Het
Ccna1 A G 3: 55,051,071 S64P probably benign Het
Dhx9 C A 1: 153,462,697 V738L probably benign Het
Dnah10 A G 5: 124,754,266 N843S probably benign Het
Dspp A G 5: 104,177,256 D495G unknown Het
Dus2 A G 8: 106,030,441 M88V probably benign Het
Dusp13 A G 14: 21,741,237 V49A probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Entpd3 A C 9: 120,554,173 R91S probably benign Het
Fam207a T C 10: 77,514,395 N53S probably benign Het
Fam83c C A 2: 155,831,639 V210F probably damaging Het
Flot1 G A 17: 35,829,978 A287T probably damaging Het
Gm11639 A T 11: 104,998,246 I4163L probably benign Het
Gm19410 A G 8: 35,806,841 K1412E probably benign Het
Gsn G A 2: 35,292,647 V241M possibly damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Heatr5a T C 12: 51,947,996 D451G possibly damaging Het
Hmcn2 G A 2: 31,426,903 W3831* probably null Het
Il3 A G 11: 54,265,549 V119A probably benign Het
Jam3 T C 9: 27,098,860 K276R probably benign Het
Kcnt1 G A 2: 25,894,314 G277D possibly damaging Het
Kif28 T A 1: 179,700,354 D744V probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Loxhd1 T C 18: 77,342,013 I535T possibly damaging Het
Lzts1 A C 8: 69,135,822 L494R probably benign Het
Mettl4 A G 17: 94,735,367 V347A probably damaging Het
Mff A G 1: 82,751,649 E270G probably damaging Het
Mroh2b A T 15: 4,900,503 I24F possibly damaging Het
Muc16 A T 9: 18,519,300 Y8102* probably null Het
Myh14 A T 7: 44,665,496 M1K probably null Het
Myo18b T A 5: 112,879,510 probably benign Het
Neurl1a C A 19: 47,257,434 P502T probably damaging Het
Nrp1 G A 8: 128,468,516 W484* probably null Het
Olfr131 T A 17: 38,082,561 H139L possibly damaging Het
Olfr1317 T A 2: 112,142,257 I104N probably benign Het
Pcdhac1 T C 18: 37,091,754 V540A possibly damaging Het
Pcdhga9 A G 18: 37,736,954 probably benign Het
Pm20d1 A C 1: 131,801,763 N176T probably benign Het
Pnldc1 T C 17: 12,897,302 D271G probably damaging Het
Pold3 A G 7: 100,112,301 V63A probably damaging Het
Rbm18 A C 2: 36,127,184 S61A probably benign Het
Rdh14 T C 12: 10,394,551 L134P probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rtel1 A G 2: 181,322,345 T46A probably damaging Het
Rtn3 T C 19: 7,434,998 I823V probably damaging Het
S1pr1 A G 3: 115,712,034 S304P probably damaging Het
Scfd2 A G 5: 74,531,363 V86A probably benign Het
Scgb1a1 C T 19: 9,085,235 V66M probably damaging Het
Sec31a A T 5: 100,378,862 M46K Het
Sgsm1 A G 5: 113,255,268 M971T probably damaging Het
Slc5a11 T C 7: 123,265,728 I419T probably benign Het
Slco6d1 A T 1: 98,466,706 T372S possibly damaging Het
Spata31 T A 13: 64,920,865 Y276N probably benign Het
Sprr2k C T 3: 92,433,489 R49W unknown Het
Ssr2 A G 3: 88,579,883 R2G possibly damaging Het
St18 C A 1: 6,828,005 T677K probably benign Het
Thap11 A T 8: 105,855,895 I179F probably damaging Het
Trf C A 9: 103,211,931 G586C probably damaging Het
Xrcc5 C A 1: 72,312,436 A55E probably damaging Het
Zfp980 G T 4: 145,702,102 R467I probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7915:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGAGTAAGCATGTTCAGGC -3'
(R):5'- GTGGCCTGAGTGTCAATGAATAAG -3'

Sequencing Primer
(F):5'- GTAAGCATGTTCAGGCTGAAATAG -3'
(R):5'- CCTGAGTGTCAATGAATAAGTCTCTC -3'
Posted On2020-06-30