Incidental Mutation 'R8089:Rgs12'
ID629832
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8089 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35020348 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 742 (I742T)
Ref Sequence ENSEMBL: ENSMUSP00000030984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684] [ENSMUST00000114280] [ENSMUST00000114281] [ENSMUST00000114283] [ENSMUST00000114284] [ENSMUST00000114285] [ENSMUST00000156339] [ENSMUST00000225237]
Predicted Effect probably damaging
Transcript: ENSMUST00000030984
AA Change: I742T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: I742T

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: I742T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: I742T

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114280
AA Change: I84T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109919
Gene: ENSMUSG00000029101
AA Change: I84T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114281
AA Change: I84T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109920
Gene: ENSMUSG00000029101
AA Change: I84T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 701 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114283
AA Change: I84T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101
AA Change: I84T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114284
AA Change: I94T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109923
Gene: ENSMUSG00000029101
AA Change: I94T

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 711 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114285
AA Change: I94T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101
AA Change: I94T

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156339
SMART Domains Protein: ENSMUSP00000115064
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Pfam:RGS 1 30 1.3e-7 PFAM
low complexity region 48 64 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156819
SMART Domains Protein: ENSMUSP00000116913
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
RBD 21 91 3.12e-28 SMART
RBD 93 163 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201936
Predicted Effect probably benign
Transcript: ENSMUST00000225237
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,274,039 V768I probably benign Het
Abcc8 G A 7: 46,108,356 T1323I probably benign Het
Adamtsl2 A G 2: 27,104,797 M828V probably benign Het
Agmo A G 12: 37,347,307 D153G probably benign Het
Akap13 T A 7: 75,610,592 V185D possibly damaging Het
Asic1 A G 15: 99,698,087 N414D probably damaging Het
Bin1 T A 18: 32,429,183 probably null Het
Ccar1 C A 10: 62,790,991 M1I probably null Het
Cdh26 T A 2: 178,457,577 probably null Het
Csmd3 C T 15: 47,669,207 D1620N Het
Dennd4a A T 9: 64,849,175 N204I probably damaging Het
Dgkb G A 12: 38,184,950 S438N probably damaging Het
Dmxl1 T C 18: 49,888,830 M1604T probably damaging Het
Fhad1 T A 4: 141,957,660 D456V probably damaging Het
Gcfc2 C T 6: 81,925,790 T86M probably damaging Het
Idua T A 5: 108,681,780 M503K probably damaging Het
Ighm T C 12: 113,421,234 probably benign Het
Kdelc2 C T 9: 53,395,962 A402V probably benign Het
Kmt2d A T 15: 98,842,869 S4676T unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Map3k13 T C 16: 21,903,817 V243A possibly damaging Het
Moxd1 A G 10: 24,281,519 T350A probably benign Het
Nalcn A T 14: 123,299,960 W1175R probably damaging Het
Olfr197 T G 16: 59,185,710 I258L unknown Het
Olfr819 A T 10: 129,966,697 M1K probably null Het
Olfr943 T A 9: 39,184,631 V148E probably damaging Het
Pacsin2 A G 15: 83,379,696 I380T probably benign Het
Plcd1 A C 9: 119,075,992 C214G possibly damaging Het
Ptprm C A 17: 66,683,488 W1385L possibly damaging Het
Rab22a C T 2: 173,688,220 Q64* probably null Het
Rasa2 G T 9: 96,553,124 H604Q probably benign Het
Rasal1 G A 5: 120,671,578 G516D probably damaging Het
Rasgrp3 A T 17: 75,497,061 I120L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scyl3 A G 1: 163,936,427 T121A possibly damaging Het
Six5 T G 7: 19,094,872 F79C probably damaging Het
Tbx3 G A 5: 119,680,569 R423H probably damaging Het
Terf2ip C T 8: 112,011,792 T104M probably benign Het
Tmem135 A G 7: 89,156,495 C234R probably damaging Het
Tnxb C G 17: 34,672,789 A702G unknown Het
Tspan1 T C 4: 116,164,335 K83R probably null Het
Ttc30b T C 2: 75,937,303 T369A possibly damaging Het
Ttn C T 2: 76,898,062 probably null Het
Usp5 A T 6: 124,820,410 probably null Het
Vmn1r27 T A 6: 58,215,209 Y270F possibly damaging Het
Vmn2r110 G A 17: 20,583,545 T256I probably benign Het
Zfp831 T A 2: 174,644,924 L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,612,732 H232N probably benign Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3826:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5480:Rgs12 UTSW 5 34966111 missense probably benign 0.09
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35020332 missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
R7082:Rgs12 UTSW 5 34966706 missense probably benign 0.00
R7250:Rgs12 UTSW 5 34965497 missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35026371 missense probably benign 0.06
R7444:Rgs12 UTSW 5 35025943 missense possibly damaging 0.65
R7632:Rgs12 UTSW 5 34965590 missense probably damaging 1.00
R8049:Rgs12 UTSW 5 35026030 missense possibly damaging 0.89
R8241:Rgs12 UTSW 5 34965773 missense probably damaging 1.00
R8797:Rgs12 UTSW 5 35029571 missense
R8928:Rgs12 UTSW 5 34966289 missense possibly damaging 0.93
Z1176:Rgs12 UTSW 5 34965769 missense probably damaging 1.00
Z1177:Rgs12 UTSW 5 34964854 start gained probably benign
Z1177:Rgs12 UTSW 5 35026352 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCCTTGAGAAAAGAGCTGTGAG -3'
(R):5'- GCTGAAGCAGAAATGTCACC -3'

Sequencing Primer
(F):5'- CCACTCACGTGTGCTGC -3'
(R):5'- GCAGAAATGTCACCGTTCTTTAAAG -3'
Posted On2020-06-30