Incidental Mutation 'R8089:Idua'
ID629833
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8089 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108681780 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 503 (M503K)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000139734] [ENSMUST00000140620]
Predicted Effect probably damaging
Transcript: ENSMUST00000071650
AA Change: M503K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: M503K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112563
AA Change: M503K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: M503K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119212
AA Change: M456K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: M456K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,274,039 V768I probably benign Het
Abcc8 G A 7: 46,108,356 T1323I probably benign Het
Adamtsl2 A G 2: 27,104,797 M828V probably benign Het
Agmo A G 12: 37,347,307 D153G probably benign Het
Akap13 T A 7: 75,610,592 V185D possibly damaging Het
Asic1 A G 15: 99,698,087 N414D probably damaging Het
Bin1 T A 18: 32,429,183 probably null Het
Ccar1 C A 10: 62,790,991 M1I probably null Het
Cdh26 T A 2: 178,457,577 probably null Het
Csmd3 C T 15: 47,669,207 D1620N Het
Dennd4a A T 9: 64,849,175 N204I probably damaging Het
Dgkb G A 12: 38,184,950 S438N probably damaging Het
Dmxl1 T C 18: 49,888,830 M1604T probably damaging Het
Fhad1 T A 4: 141,957,660 D456V probably damaging Het
Gcfc2 C T 6: 81,925,790 T86M probably damaging Het
Ighm T C 12: 113,421,234 probably benign Het
Kdelc2 C T 9: 53,395,962 A402V probably benign Het
Kmt2d A T 15: 98,842,869 S4676T unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Map3k13 T C 16: 21,903,817 V243A possibly damaging Het
Moxd1 A G 10: 24,281,519 T350A probably benign Het
Nalcn A T 14: 123,299,960 W1175R probably damaging Het
Olfr197 T G 16: 59,185,710 I258L unknown Het
Olfr819 A T 10: 129,966,697 M1K probably null Het
Olfr943 T A 9: 39,184,631 V148E probably damaging Het
Pacsin2 A G 15: 83,379,696 I380T probably benign Het
Plcd1 A C 9: 119,075,992 C214G possibly damaging Het
Ptprm C A 17: 66,683,488 W1385L possibly damaging Het
Rab22a C T 2: 173,688,220 Q64* probably null Het
Rasa2 G T 9: 96,553,124 H604Q probably benign Het
Rasal1 G A 5: 120,671,578 G516D probably damaging Het
Rasgrp3 A T 17: 75,497,061 I120L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs12 T C 5: 35,020,348 I742T probably damaging Het
Scyl3 A G 1: 163,936,427 T121A possibly damaging Het
Six5 T G 7: 19,094,872 F79C probably damaging Het
Tbx3 G A 5: 119,680,569 R423H probably damaging Het
Terf2ip C T 8: 112,011,792 T104M probably benign Het
Tmem135 A G 7: 89,156,495 C234R probably damaging Het
Tnxb C G 17: 34,672,789 A702G unknown Het
Tspan1 T C 4: 116,164,335 K83R probably null Het
Ttc30b T C 2: 75,937,303 T369A possibly damaging Het
Ttn C T 2: 76,898,062 probably null Het
Usp5 A T 6: 124,820,410 probably null Het
Vmn1r27 T A 6: 58,215,209 Y270F possibly damaging Het
Vmn2r110 G A 17: 20,583,545 T256I probably benign Het
Zfp831 T A 2: 174,644,924 L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,612,732 H232N probably benign Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
Cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R7923:Idua UTSW 5 108680583 missense probably damaging 1.00
R7980:Idua UTSW 5 108680620 missense probably benign 0.00
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
R8384:Idua UTSW 5 108681439 missense possibly damaging 0.70
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAAAGAAGGTGGGAACCC -3'
(R):5'- ATGAAGGTCTGAGCTAGCCAG -3'

Sequencing Primer
(F):5'- AACCCAGCTGTAGTGGGC -3'
(R):5'- CTTCAAGGGGCGTGTGCATAC -3'
Posted On2020-06-30