Incidental Mutation 'R8089:Kdelc2'
ID629847
Institutional Source Beutler Lab
Gene Symbol Kdelc2
Ensembl Gene ENSMUSG00000034487
Gene NameKDEL (Lys-Asp-Glu-Leu) containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8089 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53384025-53401867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53395962 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 402 (A402V)
Ref Sequence ENSEMBL: ENSMUSP00000039313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037853] [ENSMUST00000214164]
Predicted Effect probably benign
Transcript: ENSMUST00000037853
AA Change: A402V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039313
Gene: ENSMUSG00000034487
AA Change: A402V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG_FLMN 23 132 2.17e-2 SMART
Blast:CAP10 135 224 5e-48 BLAST
CAP10 226 471 7.45e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214164
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,274,039 V768I probably benign Het
Abcc8 G A 7: 46,108,356 T1323I probably benign Het
Adamtsl2 A G 2: 27,104,797 M828V probably benign Het
Agmo A G 12: 37,347,307 D153G probably benign Het
Akap13 T A 7: 75,610,592 V185D possibly damaging Het
Asic1 A G 15: 99,698,087 N414D probably damaging Het
Bin1 T A 18: 32,429,183 probably null Het
Ccar1 C A 10: 62,790,991 M1I probably null Het
Cdh26 T A 2: 178,457,577 probably null Het
Csmd3 C T 15: 47,669,207 D1620N Het
Dennd4a A T 9: 64,849,175 N204I probably damaging Het
Dgkb G A 12: 38,184,950 S438N probably damaging Het
Dmxl1 T C 18: 49,888,830 M1604T probably damaging Het
Fhad1 T A 4: 141,957,660 D456V probably damaging Het
Gcfc2 C T 6: 81,925,790 T86M probably damaging Het
Idua T A 5: 108,681,780 M503K probably damaging Het
Ighm T C 12: 113,421,234 probably benign Het
Kmt2d A T 15: 98,842,869 S4676T unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Map3k13 T C 16: 21,903,817 V243A possibly damaging Het
Moxd1 A G 10: 24,281,519 T350A probably benign Het
Nalcn A T 14: 123,299,960 W1175R probably damaging Het
Olfr197 T G 16: 59,185,710 I258L unknown Het
Olfr819 A T 10: 129,966,697 M1K probably null Het
Olfr943 T A 9: 39,184,631 V148E probably damaging Het
Pacsin2 A G 15: 83,379,696 I380T probably benign Het
Plcd1 A C 9: 119,075,992 C214G possibly damaging Het
Ptprm C A 17: 66,683,488 W1385L possibly damaging Het
Rab22a C T 2: 173,688,220 Q64* probably null Het
Rasa2 G T 9: 96,553,124 H604Q probably benign Het
Rasal1 G A 5: 120,671,578 G516D probably damaging Het
Rasgrp3 A T 17: 75,497,061 I120L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs12 T C 5: 35,020,348 I742T probably damaging Het
Scyl3 A G 1: 163,936,427 T121A possibly damaging Het
Six5 T G 7: 19,094,872 F79C probably damaging Het
Tbx3 G A 5: 119,680,569 R423H probably damaging Het
Terf2ip C T 8: 112,011,792 T104M probably benign Het
Tmem135 A G 7: 89,156,495 C234R probably damaging Het
Tnxb C G 17: 34,672,789 A702G unknown Het
Tspan1 T C 4: 116,164,335 K83R probably null Het
Ttc30b T C 2: 75,937,303 T369A possibly damaging Het
Ttn C T 2: 76,898,062 probably null Het
Usp5 A T 6: 124,820,410 probably null Het
Vmn1r27 T A 6: 58,215,209 Y270F possibly damaging Het
Vmn2r110 G A 17: 20,583,545 T256I probably benign Het
Zfp831 T A 2: 174,644,924 L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,612,732 H232N probably benign Het
Other mutations in Kdelc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdelc2 APN 9 53398028 intron probably benign
IGL00334:Kdelc2 APN 9 53398030 intron probably benign
IGL01061:Kdelc2 APN 9 53388587 unclassified probably benign
IGL01114:Kdelc2 APN 9 53388579 critical splice donor site probably null
IGL02227:Kdelc2 APN 9 53388479 missense probably damaging 0.97
IGL02646:Kdelc2 APN 9 53384251 missense probably benign 0.06
IGL02795:Kdelc2 APN 9 53392105 missense probably damaging 1.00
IGL03029:Kdelc2 APN 9 53384288 critical splice donor site probably null
R0830:Kdelc2 UTSW 9 53390711 missense probably damaging 1.00
R1256:Kdelc2 UTSW 9 53388462 missense possibly damaging 0.62
R1806:Kdelc2 UTSW 9 53395850 missense probably damaging 1.00
R5995:Kdelc2 UTSW 9 53395895 missense probably damaging 0.98
R6170:Kdelc2 UTSW 9 53399742 missense possibly damaging 0.91
R6348:Kdelc2 UTSW 9 53390440 missense probably damaging 0.97
R6833:Kdelc2 UTSW 9 53392008 missense possibly damaging 0.52
R7250:Kdelc2 UTSW 9 53390521 nonsense probably null
R7403:Kdelc2 UTSW 9 53390441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGAAAGTGGAAAATAATCCCTC -3'
(R):5'- ATCATAGTTCCCTTGATGTGCTTTG -3'

Sequencing Primer
(F):5'- GAAAGTGGAAAATAATCCCTCTGTAC -3'
(R):5'- CCCTTGATGTGCTTTGATTATGATAC -3'
Posted On2020-06-30