Incidental Mutation 'R8089:Ccar1'
ID629852
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R8089 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to A at 62790991 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000020268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000217768] [ENSMUST00000218229] [ENSMUST00000218946] [ENSMUST00000219527]
Predicted Effect probably null
Transcript: ENSMUST00000020268
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: M1I

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217768
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably null
Transcript: ENSMUST00000218229
AA Change: M1I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000218946
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably null
Transcript: ENSMUST00000219527
AA Change: M1I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,274,039 V768I probably benign Het
Abcc8 G A 7: 46,108,356 T1323I probably benign Het
Adamtsl2 A G 2: 27,104,797 M828V probably benign Het
Agmo A G 12: 37,347,307 D153G probably benign Het
Akap13 T A 7: 75,610,592 V185D possibly damaging Het
Asic1 A G 15: 99,698,087 N414D probably damaging Het
Bin1 T A 18: 32,429,183 probably null Het
Cdh26 T A 2: 178,457,577 probably null Het
Csmd3 C T 15: 47,669,207 D1620N Het
Dennd4a A T 9: 64,849,175 N204I probably damaging Het
Dgkb G A 12: 38,184,950 S438N probably damaging Het
Dmxl1 T C 18: 49,888,830 M1604T probably damaging Het
Fhad1 T A 4: 141,957,660 D456V probably damaging Het
Gcfc2 C T 6: 81,925,790 T86M probably damaging Het
Idua T A 5: 108,681,780 M503K probably damaging Het
Ighm T C 12: 113,421,234 probably benign Het
Kdelc2 C T 9: 53,395,962 A402V probably benign Het
Kmt2d A T 15: 98,842,869 S4676T unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Map3k13 T C 16: 21,903,817 V243A possibly damaging Het
Moxd1 A G 10: 24,281,519 T350A probably benign Het
Nalcn A T 14: 123,299,960 W1175R probably damaging Het
Olfr197 T G 16: 59,185,710 I258L unknown Het
Olfr819 A T 10: 129,966,697 M1K probably null Het
Olfr943 T A 9: 39,184,631 V148E probably damaging Het
Pacsin2 A G 15: 83,379,696 I380T probably benign Het
Plcd1 A C 9: 119,075,992 C214G possibly damaging Het
Ptprm C A 17: 66,683,488 W1385L possibly damaging Het
Rab22a C T 2: 173,688,220 Q64* probably null Het
Rasa2 G T 9: 96,553,124 H604Q probably benign Het
Rasal1 G A 5: 120,671,578 G516D probably damaging Het
Rasgrp3 A T 17: 75,497,061 I120L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs12 T C 5: 35,020,348 I742T probably damaging Het
Scyl3 A G 1: 163,936,427 T121A possibly damaging Het
Six5 T G 7: 19,094,872 F79C probably damaging Het
Tbx3 G A 5: 119,680,569 R423H probably damaging Het
Terf2ip C T 8: 112,011,792 T104M probably benign Het
Tmem135 A G 7: 89,156,495 C234R probably damaging Het
Tnxb C G 17: 34,672,789 A702G unknown Het
Tspan1 T C 4: 116,164,335 K83R probably null Het
Ttc30b T C 2: 75,937,303 T369A possibly damaging Het
Ttn C T 2: 76,898,062 probably null Het
Usp5 A T 6: 124,820,410 probably null Het
Vmn1r27 T A 6: 58,215,209 Y270F possibly damaging Het
Vmn2r110 G A 17: 20,583,545 T256I probably benign Het
Zfp831 T A 2: 174,644,924 L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,612,732 H232N probably benign Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 splice site probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62780457 missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1573:Ccar1 UTSW 10 62750655 missense unknown
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R3040:Ccar1 UTSW 10 62756494 missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5214:Ccar1 UTSW 10 62770961 missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62764533 missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
R8054:Ccar1 UTSW 10 62747436 missense unknown
R8202:Ccar1 UTSW 10 62771989 missense possibly damaging 0.94
R8544:Ccar1 UTSW 10 62750579 missense unknown
R8730:Ccar1 UTSW 10 62765412 missense probably damaging 1.00
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATTGCTGGATAAGTGGGG -3'
(R):5'- TTCCTTTAAGTCAGCCCCAAG -3'

Sequencing Primer
(F):5'- CAAATTGCTGGATAAGTGGGGTTTTG -3'
(R):5'- CACAAGTGATCTGTTGATAGGC -3'
Posted On2020-06-30