Incidental Mutation 'R8089:Map3k13'
ID 629863
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 067522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8089 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21722567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: V243A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: V243A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: V243A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.7%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,104,383 (GRCm39) V768I probably benign Het
Abcc8 G A 7: 45,757,780 (GRCm39) T1323I probably benign Het
Adamtsl2 A G 2: 26,994,809 (GRCm39) M828V probably benign Het
Agmo A G 12: 37,397,306 (GRCm39) D153G probably benign Het
Akap13 T A 7: 75,260,340 (GRCm39) V185D possibly damaging Het
Asic1 A G 15: 99,595,968 (GRCm39) N414D probably damaging Het
Bin1 T A 18: 32,562,236 (GRCm39) probably null Het
Ccar1 C A 10: 62,626,770 (GRCm39) M1I probably null Het
Cdh26 T A 2: 178,099,370 (GRCm39) probably null Het
Csmd3 C T 15: 47,532,603 (GRCm39) D1620N Het
Dennd4a A T 9: 64,756,457 (GRCm39) N204I probably damaging Het
Dgkb G A 12: 38,234,949 (GRCm39) S438N probably damaging Het
Dmxl1 T C 18: 50,021,897 (GRCm39) M1604T probably damaging Het
Fhad1 T A 4: 141,684,971 (GRCm39) D456V probably damaging Het
Gcfc2 C T 6: 81,902,771 (GRCm39) T86M probably damaging Het
Idua T A 5: 108,829,646 (GRCm39) M503K probably damaging Het
Ift70b T C 2: 75,767,647 (GRCm39) T369A possibly damaging Het
Ighm T C 12: 113,384,854 (GRCm39) probably benign Het
Kmt2d A T 15: 98,740,750 (GRCm39) S4676T unknown Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lmtk2 G A 5: 144,093,718 (GRCm39) V232M probably benign Het
Moxd1 A G 10: 24,157,417 (GRCm39) T350A probably benign Het
Nalcn A T 14: 123,537,372 (GRCm39) W1175R probably damaging Het
Or10u4 A T 10: 129,802,566 (GRCm39) M1K probably null Het
Or5h27 T G 16: 59,006,073 (GRCm39) I258L unknown Het
Or8g26 T A 9: 39,095,927 (GRCm39) V148E probably damaging Het
Pacsin2 A G 15: 83,263,897 (GRCm39) I380T probably benign Het
Plcd1 A C 9: 118,905,060 (GRCm39) C214G possibly damaging Het
Poglut3 C T 9: 53,307,262 (GRCm39) A402V probably benign Het
Ptprm C A 17: 66,990,483 (GRCm39) W1385L possibly damaging Het
Rab22a C T 2: 173,530,013 (GRCm39) Q64* probably null Het
Rasa2 G T 9: 96,435,177 (GRCm39) H604Q probably benign Het
Rasal1 G A 5: 120,809,643 (GRCm39) G516D probably damaging Het
Rasgrp3 A T 17: 75,804,056 (GRCm39) I120L possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs12 T C 5: 35,177,692 (GRCm39) I742T probably damaging Het
Scyl3 A G 1: 163,763,996 (GRCm39) T121A possibly damaging Het
Six5 T G 7: 18,828,797 (GRCm39) F79C probably damaging Het
Tbx3 G A 5: 119,818,634 (GRCm39) R423H probably damaging Het
Terf2ip C T 8: 112,738,424 (GRCm39) T104M probably benign Het
Tmem135 A G 7: 88,805,703 (GRCm39) C234R probably damaging Het
Tnxb C G 17: 34,891,763 (GRCm39) A702G unknown Het
Tspan1 T C 4: 116,021,532 (GRCm39) K83R probably null Het
Ttn C T 2: 76,728,406 (GRCm39) probably null Het
Usp5 A T 6: 124,797,373 (GRCm39) probably null Het
Vmn1r27 T A 6: 58,192,194 (GRCm39) Y270F possibly damaging Het
Vmn2r110 G A 17: 20,803,807 (GRCm39) T256I probably benign Het
Zfp831 T A 2: 174,486,717 (GRCm39) L464Q possibly damaging Het
Zscan4-ps3 C A 7: 11,346,659 (GRCm39) H232N probably benign Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTAGCACAGCCTGTTGC -3'
(R):5'- CGGCCACACTTGATAAAGACG -3'

Sequencing Primer
(F):5'- GCCTGTTGCTGTCTAGACTTAAG -3'
(R):5'- GGCCACACTTGATAAAGACGTCTTAC -3'
Posted On 2020-06-30