Incidental Mutation 'R8090:Gon4l'
ID629880
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R8090 (G1)
Quality Score187.009
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88892624 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 859 (I859V)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: I859V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: I859V

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: I860V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: I860V

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: I859V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: I859V

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212694
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Ifit2 T A 19: 34,573,262 N67K possibly damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt25 T A 11: 99,316,590 probably null Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
Olfr616 A T 7: 103,564,841 I146K probably benign Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Shank3 T A 15: 89,505,458 probably null Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Tdrd9 T C 12: 112,015,935 S487P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 splice site probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
R7635:Gon4l UTSW 3 88895106 missense probably benign 0.03
R7643:Gon4l UTSW 3 88902807 missense probably damaging 1.00
R7715:Gon4l UTSW 3 88908006 missense probably benign
R7773:Gon4l UTSW 3 88895795 missense probably benign 0.00
R8224:Gon4l UTSW 3 88895142 missense probably damaging 1.00
R8260:Gon4l UTSW 3 88892630 missense probably damaging 0.98
R8434:Gon4l UTSW 3 88854779 missense probably damaging 1.00
R8732:Gon4l UTSW 3 88899984 missense possibly damaging 0.95
R8812:Gon4l UTSW 3 88895007 missense possibly damaging 0.86
Z1177:Gon4l UTSW 3 88859036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCTAAGGGTGTGGGAG -3'
(R):5'- TTCCAACCCTGCTGAGTAACAC -3'

Sequencing Primer
(F):5'- GGAGGCTGTGAAGCATGC -3'
(R):5'- TGCTGAGTAACACCACAGTAAG -3'
Posted On2020-06-30