Incidental Mutation 'R8090:Olfr616'
ID629893
Institutional Source Beutler Lab
Gene Symbol Olfr616
Ensembl Gene ENSMUSG00000047544
Gene Nameolfactory receptor 616
SynonymsMOR19-1, GA_x6K02T2PBJ9-6289676-6288723
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8090 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103563747-103569143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103564841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 146 (I146K)
Ref Sequence ENSEMBL: ENSMUSP00000150171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
AA Change: I146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544
AA Change: I146K

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably benign
Transcript: ENSMUST00000214806
AA Change: I146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Predicted Effect probably benign
Transcript: ENSMUST00000217293
AA Change: I146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Gon4l A G 3: 88,892,624 I859V probably damaging Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Ifit2 T A 19: 34,573,262 N67K possibly damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt25 T A 11: 99,316,590 probably null Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Shank3 T A 15: 89,505,458 probably null Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Tdrd9 T C 12: 112,015,935 S487P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Olfr616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Olfr616 APN 7 103565021 missense probably damaging 0.99
IGL02366:Olfr616 APN 7 103564415 missense probably damaging 1.00
IGL03028:Olfr616 APN 7 103564589 splice site probably null
R0087:Olfr616 UTSW 7 103564362 missense probably benign 0.00
R1450:Olfr616 UTSW 7 103564451 missense probably benign 0.12
R1900:Olfr616 UTSW 7 103564607 nonsense probably null
R2026:Olfr616 UTSW 7 103564877 missense probably damaging 1.00
R2139:Olfr616 UTSW 7 103564754 missense possibly damaging 0.90
R2883:Olfr616 UTSW 7 103565264 missense probably benign 0.24
R4359:Olfr616 UTSW 7 103564535 missense probably benign 0.29
R4589:Olfr616 UTSW 7 103564432 missense probably damaging 0.98
R4827:Olfr616 UTSW 7 103564545 missense probably damaging 1.00
R5023:Olfr616 UTSW 7 103565171 missense possibly damaging 0.95
R5397:Olfr616 UTSW 7 103564506 missense probably damaging 0.99
R6109:Olfr616 UTSW 7 103565139 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACAATCCATAGATGATGTTGACCC -3'
(R):5'- GCAGCTACAGATGTTGGTCTC -3'

Sequencing Primer
(F):5'- CCATAGATGATGTTGACCCTGACAG -3'
(R):5'- TGCCGACAGTACTGAATGTC -3'
Posted On2020-06-30