Incidental Mutation 'R8090:Krt25'
ID629902
Institutional Source Beutler Lab
Gene Symbol Krt25
Ensembl Gene ENSMUSG00000035831
Gene Namekeratin 25
Synonyms4631426H08Rik, mIRSa1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8090 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99315516-99322951 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 99316590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038004]
Predicted Effect probably null
Transcript: ENSMUST00000038004
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Gon4l A G 3: 88,892,624 I859V probably damaging Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Ifit2 T A 19: 34,573,262 N67K possibly damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
Olfr616 A T 7: 103,564,841 I146K probably benign Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Shank3 T A 15: 89,505,458 probably null Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Tdrd9 T C 12: 112,015,935 S487P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Krt25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Krt25 APN 11 99318170 missense probably benign 0.28
IGL02415:Krt25 APN 11 99322572 missense probably damaging 1.00
IGL02816:Krt25 APN 11 99318151 missense probably benign 0.10
Plush UTSW 11 99322635 missense probably damaging 1.00
Sinuous UTSW 11 99322630 missense probably damaging 0.99
R0138:Krt25 UTSW 11 99322698 missense probably benign 0.00
R0219:Krt25 UTSW 11 99318059 missense probably benign 0.01
R0932:Krt25 UTSW 11 99321283 missense possibly damaging 0.94
R1733:Krt25 UTSW 11 99316552 nonsense probably null
R1855:Krt25 UTSW 11 99318315 missense probably damaging 1.00
R2120:Krt25 UTSW 11 99321197 missense probably benign 0.01
R2504:Krt25 UTSW 11 99317296 nonsense probably null
R3615:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R3616:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R4590:Krt25 UTSW 11 99318028 intron probably benign
R6250:Krt25 UTSW 11 99321163 missense probably damaging 1.00
R6331:Krt25 UTSW 11 99317427 missense probably damaging 1.00
R6927:Krt25 UTSW 11 99317379 missense probably damaging 1.00
R7067:Krt25 UTSW 11 99317383 missense probably benign 0.01
R7289:Krt25 UTSW 11 99321272 missense probably benign 0.15
R7360:Krt25 UTSW 11 99317406 missense probably benign 0.01
R8057:Krt25 UTSW 11 99317343 missense probably benign 0.44
Z1176:Krt25 UTSW 11 99322822 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGACATCTAGCATGCAATGGC -3'
(R):5'- ATGTTAAGTGTTAAGCATCCGCAC -3'

Sequencing Primer
(F):5'- GCAATGGCATCTACTCTAAGTCTTAC -3'
(R):5'- GTTAAGCATCCGCACTCCACTG -3'
Posted On2020-06-30