Incidental Mutation 'R8090:Tdrd9'
ID629906
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8090 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112015935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 487 (S487P)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: S487P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: S487P

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Gon4l A G 3: 88,892,624 I859V probably damaging Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Ifit2 T A 19: 34,573,262 N67K possibly damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt25 T A 11: 99,316,590 probably null Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
Olfr616 A T 7: 103,564,841 I146K probably benign Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Shank3 T A 15: 89,505,458 probably null Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 splice site probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
R7751:Tdrd9 UTSW 12 111992548 missense probably benign 0.09
R7809:Tdrd9 UTSW 12 112032721 missense probably damaging 0.99
R7844:Tdrd9 UTSW 12 111997952 missense possibly damaging 0.63
R7854:Tdrd9 UTSW 12 112046961 missense probably benign 0.00
R7903:Tdrd9 UTSW 12 112051976 missense possibly damaging 0.95
R7938:Tdrd9 UTSW 12 112031215 missense possibly damaging 0.86
R8018:Tdrd9 UTSW 12 112032746 missense probably benign 0.12
R8018:Tdrd9 UTSW 12 112044388 missense probably damaging 0.99
R8157:Tdrd9 UTSW 12 111985066 missense probably benign 0.44
R8198:Tdrd9 UTSW 12 112040429 missense probably damaging 1.00
R8203:Tdrd9 UTSW 12 112025630 missense probably damaging 1.00
R8512:Tdrd9 UTSW 12 112046193 missense probably benign
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Z1177:Tdrd9 UTSW 12 111971654 missense probably benign 0.08
Z1177:Tdrd9 UTSW 12 111993891 missense probably damaging 0.96
Z1177:Tdrd9 UTSW 12 112015921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCATAATCCCACCAGC -3'
(R):5'- CCCTTAGCAGCTGACACTAAG -3'

Sequencing Primer
(F):5'- CAGCTGGGTGGTCACAC -3'
(R):5'- CAGCTCAAGATTAAAACATGGAATC -3'
Posted On2020-06-30