Incidental Mutation 'R8090:Shank3'
ID629913
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R8090 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 89505458 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309]
Predicted Effect probably null
Transcript: ENSMUST00000039074
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109309
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 92.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat T C 11: 116,596,191 C75R probably damaging Het
Ackr2 A G 9: 121,908,979 D140G possibly damaging Het
Adgrv1 C A 13: 81,448,834 probably null Het
Arpp21 A G 9: 112,116,701 L593S unknown Het
Atn1 G A 6: 124,745,341 P850S unknown Het
Capn13 G A 17: 73,382,854 S54L probably benign Het
Cd1d2 C T 3: 86,986,657 P5S possibly damaging Het
Cgn A G 3: 94,779,953 V13A probably damaging Het
Clint1 T C 11: 45,887,440 V136A probably damaging Het
Cox5a T A 9: 57,529,063 L66M probably damaging Het
Crb2 G T 2: 37,795,491 C1205F probably damaging Het
Ddx3y C T Y: 1,264,897 S519N probably benign Het
Defb50 G A 8: 21,831,071 G26S probably damaging Het
Dock8 T C 19: 25,154,242 L1112P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Gm9573 G C 17: 35,621,725 T523S unknown Het
Gm9837 A G 11: 53,470,238 S50P unknown Het
Gon4l A G 3: 88,892,624 I859V probably damaging Het
Grin3a A T 4: 49,714,224 D840E probably damaging Het
Ifit2 T A 19: 34,573,262 N67K possibly damaging Het
Il17re G A 6: 113,462,289 W53* probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Krt25 T A 11: 99,316,590 probably null Het
Krt26 T C 11: 99,336,489 M171V probably benign Het
Lrba T C 3: 86,348,489 L1046S probably benign Het
Lrp2 G T 2: 69,464,745 P3410T possibly damaging Het
Madd T C 2: 91,155,623 K1241R probably benign Het
Mcm8 T G 2: 132,831,649 S402A probably benign Het
Mpc1 A C 17: 8,296,873 Q74H probably benign Het
Mroh4 A G 15: 74,624,701 V279A probably benign Het
Ndufs2 A T 1: 171,236,678 H380Q probably damaging Het
Nkx2-6 T C 14: 69,172,016 L72P possibly damaging Het
Nme6 T A 9: 109,841,951 L73* probably null Het
Odf2l G T 3: 145,127,035 A85S probably damaging Het
Olfr616 A T 7: 103,564,841 I146K probably benign Het
P4ha3 T A 7: 100,300,652 C109S probably damaging Het
Plpp6 C T 19: 28,964,871 Q291* probably null Het
Plxnd1 G A 6: 115,956,617 A1855V probably damaging Het
Ptcd1 A T 5: 145,159,535 H249Q possibly damaging Het
Rnf149 C A 1: 39,577,223 A18S unknown Het
Scara5 C T 14: 65,742,137 R368* probably null Het
Sfmbt2 G A 2: 10,461,379 D342N probably benign Het
Slc22a27 A G 19: 7,865,736 probably null Het
Srgap3 G T 6: 112,781,035 Y170* probably null Het
Szt2 A T 4: 118,387,002 probably null Het
Tbccd1 A G 16: 22,842,055 S4P probably benign Het
Tcf20 A G 15: 82,856,006 S415P probably damaging Het
Tdrd9 T C 12: 112,015,935 S487P probably damaging Het
Trim26 A G 17: 36,856,748 Q300R possibly damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yif1b A G 7: 29,244,301 N93S probably benign Het
Zdhhc22 C A 12: 86,983,620 V185F probably benign Het
Zfp638 G T 6: 83,929,819 S322I probably damaging Het
Zfp786 T A 6: 47,820,009 H665L probably damaging Het
Zfp799 C T 17: 32,820,975 V106I probably benign Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7088:Shank3 UTSW 15 89503525 splice site probably null
R7390:Shank3 UTSW 15 89549312 missense probably benign 0.05
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R8039:Shank3 UTSW 15 89505439 missense probably damaging 1.00
R8170:Shank3 UTSW 15 89548840 missense possibly damaging 0.69
R8189:Shank3 UTSW 15 89549236 missense probably benign
R8246:Shank3 UTSW 15 89533346 missense possibly damaging 0.90
R8515:Shank3 UTSW 15 89503572 nonsense probably null
R8525:Shank3 UTSW 15 89547770 missense probably damaging 0.99
R8537:Shank3 UTSW 15 89532215 missense probably damaging 1.00
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Z1177:Shank3 UTSW 15 89558322 makesense probably null
Predicted Primers PCR Primer
(F):5'- CTCTTGTCTTTAAGAGGTGAGGTCC -3'
(R):5'- GGCCCTGACCAAGAATTCTG -3'

Sequencing Primer
(F):5'- AGGTCCCAGTAGACATTTTGGC -3'
(R):5'- GAATTCTGTTCAGTCCACACAGG -3'
Posted On2020-06-30