Incidental Mutation 'R8092:Mettl11b'
ID629926
Institutional Source Beutler Lab
Gene Symbol Mettl11b
Ensembl Gene ENSMUSG00000040113
Gene Namemethyltransferase like 11B
SynonymsLOC240879
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8092 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location163702256-163725232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163717250 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 55 (Y55H)
Ref Sequence ENSEMBL: ENSMUSP00000124211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159679] [ENSMUST00000160495]
Predicted Effect probably damaging
Transcript: ENSMUST00000159679
AA Change: Y55H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124211
Gene: ENSMUSG00000040113
AA Change: Y55H

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 64 278 5.7e-74 PFAM
Pfam:Methyltransf_11 121 220 4.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160495
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Dsg1c A G 18: 20,281,972 Y642C probably damaging Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Ntn4 A C 10: 93,741,056 K529Q probably damaging Het
Olfr1308 C A 2: 111,960,307 M255I probably benign Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Tex101 G A 7: 24,670,353 T62M probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zbtb42 G T 12: 112,679,841 C150F probably damaging Het
Other mutations in Mettl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Mettl11b APN 1 163725003 missense probably damaging 1.00
IGL01973:Mettl11b APN 1 163717120 missense probably benign 0.00
IGL02418:Mettl11b APN 1 163703156 missense probably damaging 1.00
IGL02597:Mettl11b APN 1 163717087 missense probably benign 0.00
IGL03060:Mettl11b APN 1 163717123 missense probably damaging 1.00
IGL03162:Mettl11b APN 1 163703214 missense probably damaging 0.98
R4569:Mettl11b UTSW 1 163703017 makesense probably null
R4618:Mettl11b UTSW 1 163725028 missense probably damaging 1.00
R4888:Mettl11b UTSW 1 163703064 missense probably benign 0.11
R5165:Mettl11b UTSW 1 163722523 missense probably benign 0.01
R6353:Mettl11b UTSW 1 163704111 missense possibly damaging 0.94
R6503:Mettl11b UTSW 1 163704146 missense probably damaging 1.00
R7726:Mettl11b UTSW 1 163703184 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCTCTACTCCAGCATCAGTCAG -3'
(R):5'- ATGCCAATCTCTAGGCTAGAACTC -3'

Sequencing Primer
(F):5'- TACTCCAGCATCAGTCAGAAAACTC -3'
(R):5'- TGAGCCAAGCCTGGTCTATATAGC -3'
Posted On2020-06-30