Incidental Mutation 'R8092:Olfr1308'
ID629929
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Nameolfactory receptor 1308
SynonymsMOR245-22, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8092 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111959285-111964944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111960307 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 255 (M255I)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
Predicted Effect probably benign
Transcript: ENSMUST00000099605
AA Change: M255I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: M255I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207560
AA Change: M255I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dnajc3 A T 14: 118,970,582 probably null Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Dsg1c A G 18: 20,281,972 Y642C probably damaging Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Mettl11b A G 1: 163,717,250 Y55H probably damaging Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Ntn4 A C 10: 93,741,056 K529Q probably damaging Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Tex101 G A 7: 24,670,353 T62M probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zbtb42 G T 12: 112,679,841 C150F probably damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTTAAGACTGATCAGAGTGCAAGTG -3'
(R):5'- TTGCCTGTATAGACACATACAGAC -3'

Sequencing Primer
(F):5'- AGATCACTGGGTTCAGAAA -3'
(R):5'- CACATACAGACTGAAGTTACTGGTC -3'
Posted On2020-06-30