Incidental Mutation 'R8092:Pclo'
ID 629936
Institutional Source Beutler Lab
Gene Symbol Pclo
Ensembl Gene ENSMUSG00000061601
Gene Name piccolo (presynaptic cytomatrix protein)
Synonyms Acz, Pico
MMRRC Submission 067524-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8092 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 14564932-14913473 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14727560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2139 (D2139E)
Ref Sequence ENSEMBL: ENSMUSP00000030691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030691] [ENSMUST00000182407]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000030691
AA Change: D2139E
SMART Domains Protein: ENSMUSP00000030691
Gene: ENSMUSG00000061601
AA Change: D2139E

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.23e-13 PROSPERO
internal_repeat_2 305 389 1.23e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 530 589 5.2e-30 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 995 1053 6.7e-33 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_4 1196 1249 1.65e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_4 3473 3521 1.65e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
low complexity region 4870 4892 N/A INTRINSIC
C2 4951 5057 8.56e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182407
AA Change: D2139E
SMART Domains Protein: ENSMUSP00000138419
Gene: ENSMUSG00000061601
AA Change: D2139E

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.06e-13 PROSPERO
internal_repeat_2 305 389 1.06e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 528 589 3e-36 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 993 1053 4.3e-37 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_3 1196 1249 1.46e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_3 3473 3521 1.46e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182915
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,427,831 (GRCm39) S483P possibly damaging Het
Agr3 T A 12: 35,997,593 (GRCm39) probably null Het
Anxa4 T C 6: 86,718,873 (GRCm39) D282G probably damaging Het
Aplp2 A C 9: 31,074,640 (GRCm39) probably null Het
Arfgef2 G A 2: 166,701,754 (GRCm39) V714M probably damaging Het
Cep295 A T 9: 15,244,278 (GRCm39) F1393I probably benign Het
Cfap206 G A 4: 34,728,897 (GRCm39) P3S possibly damaging Het
Chd5 T A 4: 152,463,261 (GRCm39) D1410E probably damaging Het
Chd8 T C 14: 52,455,184 (GRCm39) Y1101C probably damaging Het
Chtf8 A G 8: 107,612,938 (GRCm39) V121A possibly damaging Het
Dnajc3 A T 14: 119,207,994 (GRCm39) probably null Het
Dpys C T 15: 39,710,010 (GRCm39) D140N probably benign Het
Dsg1c A G 18: 20,415,029 (GRCm39) Y642C probably damaging Het
Eif2ak4 G A 2: 118,272,513 (GRCm39) V901I probably damaging Het
Gm45861 T C 8: 28,057,823 (GRCm39) M1127T unknown Het
Gnpnat1 A G 14: 45,618,388 (GRCm39) probably null Het
Hsd3b6 T A 3: 98,713,456 (GRCm39) D281V possibly damaging Het
Kng2 T A 16: 22,806,672 (GRCm39) Q509L probably benign Het
Lipo2 A T 19: 33,726,880 (GRCm39) D52E probably benign Het
Ly6g6c A G 17: 35,287,867 (GRCm39) Y27C probably damaging Het
Mcc G A 18: 44,892,299 (GRCm39) T105I probably benign Het
Neurl4 A G 11: 69,801,891 (GRCm39) K1279E probably benign Het
Ntmt2 A G 1: 163,544,819 (GRCm39) Y55H probably damaging Het
Ntn4 A C 10: 93,576,918 (GRCm39) K529Q probably damaging Het
Or4f57 C A 2: 111,790,652 (GRCm39) M255I probably benign Het
P2ry14 C T 3: 59,022,867 (GRCm39) V198M probably damaging Het
Plxnb1 T A 9: 108,929,573 (GRCm39) V143E probably damaging Het
Prune2 G T 19: 17,097,357 (GRCm39) D954Y probably damaging Het
Qrsl1 G A 10: 43,760,749 (GRCm39) P278L probably damaging Het
Rnf17 C T 14: 56,724,479 (GRCm39) R1108C probably benign Het
Sipa1l2 T C 8: 126,145,907 (GRCm39) S1716G probably benign Het
Slfn4 A T 11: 83,079,831 (GRCm39) H507L probably benign Het
Snx18 T C 13: 113,753,685 (GRCm39) E416G probably damaging Het
Srp9 T C 1: 181,959,001 (GRCm39) V81A probably benign Het
Tex101 G A 7: 24,369,778 (GRCm39) T62M probably damaging Het
Utp25 G A 1: 192,802,671 (GRCm39) L349F probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Zbtb42 G T 12: 112,646,275 (GRCm39) C150F probably damaging Het
Other mutations in Pclo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Pclo APN 5 14,571,691 (GRCm39) nonsense probably null
IGL00429:Pclo APN 5 14,730,753 (GRCm39) unclassified probably benign
IGL00498:Pclo APN 5 14,590,753 (GRCm39) missense unknown
IGL00528:Pclo APN 5 14,726,448 (GRCm39) unclassified probably benign
IGL00743:Pclo APN 5 14,728,035 (GRCm39) unclassified probably benign
IGL00809:Pclo APN 5 14,725,811 (GRCm39) missense unknown
IGL00811:Pclo APN 5 14,730,024 (GRCm39) unclassified probably benign
IGL00819:Pclo APN 5 14,908,860 (GRCm39) missense unknown
IGL00870:Pclo APN 5 14,589,997 (GRCm39) missense unknown
IGL00925:Pclo APN 5 14,816,755 (GRCm39) missense unknown
IGL00960:Pclo APN 5 14,725,234 (GRCm39) missense unknown
IGL01013:Pclo APN 5 14,843,848 (GRCm39) missense unknown
IGL01112:Pclo APN 5 14,731,083 (GRCm39) missense unknown
IGL01124:Pclo APN 5 14,764,343 (GRCm39) missense unknown
IGL01150:Pclo APN 5 14,726,926 (GRCm39) unclassified probably benign
IGL01302:Pclo APN 5 14,726,013 (GRCm39) unclassified probably benign
IGL01389:Pclo APN 5 14,764,535 (GRCm39) missense probably damaging 0.99
IGL01448:Pclo APN 5 14,726,408 (GRCm39) unclassified probably benign
IGL01449:Pclo APN 5 14,728,530 (GRCm39) unclassified probably benign
IGL01450:Pclo APN 5 14,727,207 (GRCm39) unclassified probably benign
IGL01476:Pclo APN 5 14,571,122 (GRCm39) missense probably damaging 1.00
IGL01537:Pclo APN 5 14,589,647 (GRCm39) missense unknown
IGL01568:Pclo APN 5 14,728,443 (GRCm39) unclassified probably benign
IGL01574:Pclo APN 5 14,763,462 (GRCm39) missense unknown
IGL01637:Pclo APN 5 14,590,048 (GRCm39) missense unknown
IGL01646:Pclo APN 5 14,763,881 (GRCm39) missense unknown
IGL01672:Pclo APN 5 14,728,549 (GRCm39) unclassified probably benign
IGL01705:Pclo APN 5 14,727,879 (GRCm39) unclassified probably benign
IGL02127:Pclo APN 5 14,815,159 (GRCm39) splice site probably benign
IGL02215:Pclo APN 5 14,906,999 (GRCm39) missense unknown
IGL02271:Pclo APN 5 14,729,508 (GRCm39) unclassified probably benign
IGL02300:Pclo APN 5 14,763,755 (GRCm39) missense unknown
IGL02346:Pclo APN 5 14,727,552 (GRCm39) unclassified probably benign
IGL02449:Pclo APN 5 14,565,357 (GRCm39) missense probably damaging 1.00
IGL02452:Pclo APN 5 14,726,980 (GRCm39) unclassified probably benign
IGL02455:Pclo APN 5 14,590,189 (GRCm39) missense unknown
IGL02478:Pclo APN 5 14,816,792 (GRCm39) missense unknown
IGL02677:Pclo APN 5 14,726,943 (GRCm39) unclassified probably benign
IGL02711:Pclo APN 5 14,572,322 (GRCm39) missense unknown
IGL02737:Pclo APN 5 14,764,177 (GRCm39) missense unknown
IGL02943:Pclo APN 5 14,719,235 (GRCm39) missense unknown
IGL03184:Pclo APN 5 14,764,457 (GRCm39) missense probably damaging 1.00
IGL03246:Pclo APN 5 14,727,631 (GRCm39) unclassified probably benign
IGL03263:Pclo APN 5 14,731,824 (GRCm39) missense unknown
IGL03300:Pclo APN 5 14,762,812 (GRCm39) missense unknown
IGL03399:Pclo APN 5 14,816,745 (GRCm39) missense unknown
Gauche UTSW 5 14,843,869 (GRCm39) missense unknown
P0018:Pclo UTSW 5 14,727,735 (GRCm39) unclassified probably benign
PIT4472001:Pclo UTSW 5 14,763,182 (GRCm39) missense possibly damaging 0.54
R0014:Pclo UTSW 5 14,730,465 (GRCm39) unclassified probably benign
R0014:Pclo UTSW 5 14,730,465 (GRCm39) unclassified probably benign
R0020:Pclo UTSW 5 14,719,687 (GRCm39) missense unknown
R0045:Pclo UTSW 5 14,589,485 (GRCm39) missense unknown
R0046:Pclo UTSW 5 14,590,493 (GRCm39) missense unknown
R0046:Pclo UTSW 5 14,590,493 (GRCm39) missense unknown
R0128:Pclo UTSW 5 14,729,811 (GRCm39) unclassified probably benign
R0130:Pclo UTSW 5 14,729,811 (GRCm39) unclassified probably benign
R0141:Pclo UTSW 5 14,841,936 (GRCm39) missense unknown
R0226:Pclo UTSW 5 14,815,237 (GRCm39) missense probably damaging 0.99
R0243:Pclo UTSW 5 14,825,434 (GRCm39) missense unknown
R0267:Pclo UTSW 5 14,731,194 (GRCm39) missense unknown
R0313:Pclo UTSW 5 14,728,887 (GRCm39) unclassified probably benign
R0324:Pclo UTSW 5 14,719,447 (GRCm39) missense unknown
R0331:Pclo UTSW 5 14,730,390 (GRCm39) unclassified probably benign
R0370:Pclo UTSW 5 14,571,104 (GRCm39) missense probably damaging 1.00
R0398:Pclo UTSW 5 14,731,716 (GRCm39) missense unknown
R0401:Pclo UTSW 5 14,731,748 (GRCm39) missense unknown
R0417:Pclo UTSW 5 14,763,036 (GRCm39) missense unknown
R0468:Pclo UTSW 5 14,727,302 (GRCm39) unclassified probably benign
R0472:Pclo UTSW 5 14,731,608 (GRCm39) missense unknown
R0488:Pclo UTSW 5 14,719,313 (GRCm39) missense unknown
R0511:Pclo UTSW 5 14,729,412 (GRCm39) unclassified probably benign
R0511:Pclo UTSW 5 14,728,299 (GRCm39) unclassified probably benign
R0520:Pclo UTSW 5 14,763,844 (GRCm39) nonsense probably null
R0547:Pclo UTSW 5 14,842,086 (GRCm39) missense unknown
R0611:Pclo UTSW 5 14,762,828 (GRCm39) missense unknown
R0611:Pclo UTSW 5 14,728,789 (GRCm39) unclassified probably benign
R0624:Pclo UTSW 5 14,719,670 (GRCm39) missense unknown
R0628:Pclo UTSW 5 14,719,552 (GRCm39) missense unknown
R0639:Pclo UTSW 5 14,731,763 (GRCm39) nonsense probably null
R0653:Pclo UTSW 5 14,732,269 (GRCm39) intron probably benign
R0681:Pclo UTSW 5 14,725,332 (GRCm39) missense unknown
R0689:Pclo UTSW 5 14,764,033 (GRCm39) missense unknown
R0698:Pclo UTSW 5 14,762,530 (GRCm39) missense unknown
R0737:Pclo UTSW 5 14,565,453 (GRCm39) missense probably damaging 1.00
R0883:Pclo UTSW 5 14,727,873 (GRCm39) nonsense probably null
R0906:Pclo UTSW 5 14,726,700 (GRCm39) unclassified probably benign
R1056:Pclo UTSW 5 14,590,069 (GRCm39) nonsense probably null
R1107:Pclo UTSW 5 14,727,883 (GRCm39) unclassified probably benign
R1174:Pclo UTSW 5 14,727,660 (GRCm39) unclassified probably benign
R1184:Pclo UTSW 5 14,572,276 (GRCm39) missense unknown
R1302:Pclo UTSW 5 14,731,647 (GRCm39) missense unknown
R1318:Pclo UTSW 5 14,729,328 (GRCm39) unclassified probably benign
R1342:Pclo UTSW 5 14,732,191 (GRCm39) intron probably benign
R1378:Pclo UTSW 5 14,732,327 (GRCm39) missense probably benign 0.23
R1418:Pclo UTSW 5 14,728,144 (GRCm39) unclassified probably benign
R1471:Pclo UTSW 5 14,730,441 (GRCm39) unclassified probably benign
R1485:Pclo UTSW 5 14,763,793 (GRCm39) missense unknown
R1523:Pclo UTSW 5 14,838,420 (GRCm39) missense unknown
R1527:Pclo UTSW 5 14,729,662 (GRCm39) unclassified probably benign
R1531:Pclo UTSW 5 14,571,917 (GRCm39) missense probably damaging 0.99
R1537:Pclo UTSW 5 14,762,489 (GRCm39) missense unknown
R1574:Pclo UTSW 5 14,729,845 (GRCm39) unclassified probably benign
R1574:Pclo UTSW 5 14,729,845 (GRCm39) unclassified probably benign
R1581:Pclo UTSW 5 14,571,296 (GRCm39) missense probably benign 0.28
R1613:Pclo UTSW 5 14,729,146 (GRCm39) unclassified probably benign
R1632:Pclo UTSW 5 14,730,017 (GRCm39) unclassified probably benign
R1688:Pclo UTSW 5 14,838,507 (GRCm39) critical splice donor site probably null
R1694:Pclo UTSW 5 14,570,977 (GRCm39) missense probably damaging 1.00
R1707:Pclo UTSW 5 14,763,238 (GRCm39) missense unknown
R1727:Pclo UTSW 5 14,727,001 (GRCm39) unclassified probably benign
R1741:Pclo UTSW 5 14,726,524 (GRCm39) unclassified probably benign
R1853:Pclo UTSW 5 14,726,698 (GRCm39) unclassified probably benign
R1856:Pclo UTSW 5 14,828,566 (GRCm39) missense probably damaging 1.00
R1907:Pclo UTSW 5 14,728,525 (GRCm39) unclassified probably benign
R1970:Pclo UTSW 5 14,763,487 (GRCm39) missense unknown
R1971:Pclo UTSW 5 14,763,487 (GRCm39) missense unknown
R1973:Pclo UTSW 5 14,726,073 (GRCm39) splice site probably null
R1978:Pclo UTSW 5 14,763,809 (GRCm39) missense unknown
R1999:Pclo UTSW 5 14,727,094 (GRCm39) unclassified probably benign
R2015:Pclo UTSW 5 14,571,515 (GRCm39) missense probably damaging 0.98
R2084:Pclo UTSW 5 14,732,162 (GRCm39) missense probably benign 0.23
R2144:Pclo UTSW 5 14,908,766 (GRCm39) missense unknown
R2155:Pclo UTSW 5 14,764,309 (GRCm39) missense probably benign 0.02
R2191:Pclo UTSW 5 14,763,862 (GRCm39) missense unknown
R2237:Pclo UTSW 5 14,763,952 (GRCm39) missense unknown
R2276:Pclo UTSW 5 14,764,287 (GRCm39) missense unknown
R2279:Pclo UTSW 5 14,764,287 (GRCm39) missense unknown
R2281:Pclo UTSW 5 14,590,346 (GRCm39) missense unknown
R2307:Pclo UTSW 5 14,728,665 (GRCm39) unclassified probably benign
R2386:Pclo UTSW 5 14,815,261 (GRCm39) missense unknown
R2407:Pclo UTSW 5 14,728,946 (GRCm39) unclassified probably benign
R2512:Pclo UTSW 5 14,762,612 (GRCm39) missense unknown
R2889:Pclo UTSW 5 14,906,995 (GRCm39) missense unknown
R2966:Pclo UTSW 5 14,731,164 (GRCm39) missense unknown
R3151:Pclo UTSW 5 14,571,692 (GRCm39) missense probably damaging 0.99
R3424:Pclo UTSW 5 14,730,432 (GRCm39) unclassified probably benign
R3687:Pclo UTSW 5 14,719,009 (GRCm39) missense unknown
R3719:Pclo UTSW 5 14,571,175 (GRCm39) missense probably benign 0.33
R3739:Pclo UTSW 5 14,730,913 (GRCm39) missense unknown
R3745:Pclo UTSW 5 14,728,435 (GRCm39) unclassified probably benign
R3771:Pclo UTSW 5 14,589,422 (GRCm39) critical splice acceptor site probably null
R3789:Pclo UTSW 5 14,730,464 (GRCm39) unclassified probably benign
R3803:Pclo UTSW 5 14,565,416 (GRCm39) nonsense probably null
R3902:Pclo UTSW 5 14,762,536 (GRCm39) missense probably benign 0.01
R3942:Pclo UTSW 5 14,729,932 (GRCm39) unclassified probably benign
R4061:Pclo UTSW 5 14,590,580 (GRCm39) missense unknown
R4094:Pclo UTSW 5 14,905,659 (GRCm39) missense unknown
R4175:Pclo UTSW 5 14,763,889 (GRCm39) missense probably damaging 0.99
R4195:Pclo UTSW 5 14,727,577 (GRCm39) unclassified probably benign
R4398:Pclo UTSW 5 14,825,380 (GRCm39) missense probably damaging 1.00
R4429:Pclo UTSW 5 14,728,114 (GRCm39) unclassified probably benign
R4523:Pclo UTSW 5 14,730,006 (GRCm39) unclassified probably benign
R4531:Pclo UTSW 5 14,825,422 (GRCm39) missense unknown
R4552:Pclo UTSW 5 14,719,285 (GRCm39) missense unknown
R4563:Pclo UTSW 5 14,571,383 (GRCm39) missense probably damaging 1.00
R4581:Pclo UTSW 5 14,725,519 (GRCm39) missense unknown
R4638:Pclo UTSW 5 14,730,447 (GRCm39) nonsense probably null
R4655:Pclo UTSW 5 14,732,397 (GRCm39) intron probably benign
R4703:Pclo UTSW 5 14,726,494 (GRCm39) unclassified probably benign
R4704:Pclo UTSW 5 14,726,494 (GRCm39) unclassified probably benign
R4705:Pclo UTSW 5 14,726,494 (GRCm39) unclassified probably benign
R4706:Pclo UTSW 5 14,764,221 (GRCm39) missense unknown
R4709:Pclo UTSW 5 14,828,572 (GRCm39) missense unknown
R4755:Pclo UTSW 5 14,764,362 (GRCm39) missense unknown
R4786:Pclo UTSW 5 14,773,281 (GRCm39) missense unknown
R4801:Pclo UTSW 5 14,725,829 (GRCm39) missense unknown
R4802:Pclo UTSW 5 14,725,829 (GRCm39) missense unknown
R4812:Pclo UTSW 5 14,590,039 (GRCm39) missense unknown
R4817:Pclo UTSW 5 14,763,139 (GRCm39) missense unknown
R4817:Pclo UTSW 5 14,725,045 (GRCm39) missense unknown
R4845:Pclo UTSW 5 14,729,132 (GRCm39) unclassified probably benign
R4876:Pclo UTSW 5 14,861,694 (GRCm39) missense unknown
R4907:Pclo UTSW 5 14,730,065 (GRCm39) unclassified probably benign
R4943:Pclo UTSW 5 14,762,651 (GRCm39) missense unknown
R4963:Pclo UTSW 5 14,719,235 (GRCm39) missense unknown
R4970:Pclo UTSW 5 14,727,896 (GRCm39) unclassified probably benign
R4978:Pclo UTSW 5 14,764,492 (GRCm39) missense probably benign 0.23
R4982:Pclo UTSW 5 14,729,308 (GRCm39) unclassified probably benign
R5019:Pclo UTSW 5 14,764,381 (GRCm39) missense unknown
R5068:Pclo UTSW 5 14,729,087 (GRCm39) unclassified probably benign
R5092:Pclo UTSW 5 14,727,322 (GRCm39) unclassified probably benign
R5112:Pclo UTSW 5 14,727,896 (GRCm39) unclassified probably benign
R5124:Pclo UTSW 5 14,727,406 (GRCm39) unclassified probably benign
R5210:Pclo UTSW 5 14,763,464 (GRCm39) missense probably damaging 0.99
R5227:Pclo UTSW 5 14,763,574 (GRCm39) missense probably benign 0.23
R5264:Pclo UTSW 5 14,726,937 (GRCm39) unclassified probably benign
R5280:Pclo UTSW 5 14,590,731 (GRCm39) missense unknown
R5286:Pclo UTSW 5 14,729,761 (GRCm39) unclassified probably benign
R5297:Pclo UTSW 5 14,726,263 (GRCm39) unclassified probably benign
R5344:Pclo UTSW 5 14,726,626 (GRCm39) unclassified probably benign
R5354:Pclo UTSW 5 14,728,822 (GRCm39) unclassified probably benign
R5358:Pclo UTSW 5 14,762,750 (GRCm39) nonsense probably null
R5363:Pclo UTSW 5 14,719,424 (GRCm39) missense unknown
R5377:Pclo UTSW 5 14,731,367 (GRCm39) missense unknown
R5457:Pclo UTSW 5 14,726,157 (GRCm39) unclassified probably benign
R5468:Pclo UTSW 5 14,730,966 (GRCm39) missense unknown
R5588:Pclo UTSW 5 14,838,412 (GRCm39) missense unknown
R5836:Pclo UTSW 5 14,728,549 (GRCm39) unclassified probably benign
R5865:Pclo UTSW 5 14,764,492 (GRCm39) missense probably benign 0.23
R5875:Pclo UTSW 5 14,730,614 (GRCm39) unclassified probably benign
R5892:Pclo UTSW 5 14,571,185 (GRCm39) missense probably damaging 1.00
R5905:Pclo UTSW 5 14,730,399 (GRCm39) unclassified probably benign
R5967:Pclo UTSW 5 14,590,669 (GRCm39) missense unknown
R6046:Pclo UTSW 5 14,763,302 (GRCm39) missense unknown
R6059:Pclo UTSW 5 14,861,714 (GRCm39) missense unknown
R6092:Pclo UTSW 5 14,727,937 (GRCm39) unclassified probably benign
R6119:Pclo UTSW 5 14,727,033 (GRCm39) unclassified probably benign
R6221:Pclo UTSW 5 14,725,327 (GRCm39) missense unknown
R6243:Pclo UTSW 5 14,726,457 (GRCm39) unclassified probably benign
R6269:Pclo UTSW 5 14,572,108 (GRCm39) nonsense probably null
R6303:Pclo UTSW 5 14,727,907 (GRCm39) unclassified probably benign
R6304:Pclo UTSW 5 14,727,907 (GRCm39) unclassified probably benign
R6453:Pclo UTSW 5 14,726,803 (GRCm39) unclassified probably benign
R6460:Pclo UTSW 5 14,729,146 (GRCm39) unclassified probably benign
R6497:Pclo UTSW 5 14,843,869 (GRCm39) missense unknown
R6498:Pclo UTSW 5 14,719,505 (GRCm39) missense unknown
R6524:Pclo UTSW 5 14,768,883 (GRCm39) missense unknown
R6682:Pclo UTSW 5 14,589,893 (GRCm39) missense unknown
R6823:Pclo UTSW 5 14,727,921 (GRCm39) unclassified probably benign
R6830:Pclo UTSW 5 14,731,113 (GRCm39) missense unknown
R6831:Pclo UTSW 5 14,838,443 (GRCm39) nonsense probably null
R6965:Pclo UTSW 5 14,731,976 (GRCm39) intron probably benign
R7012:Pclo UTSW 5 14,800,493 (GRCm39) missense unknown
R7028:Pclo UTSW 5 14,763,461 (GRCm39) missense unknown
R7030:Pclo UTSW 5 14,726,421 (GRCm39) missense probably benign 0.23
R7130:Pclo UTSW 5 14,729,356 (GRCm39) missense unknown
R7141:Pclo UTSW 5 14,729,271 (GRCm39) missense unknown
R7143:Pclo UTSW 5 14,908,836 (GRCm39) missense unknown
R7189:Pclo UTSW 5 14,571,932 (GRCm39) missense possibly damaging 0.83
R7190:Pclo UTSW 5 14,729,743 (GRCm39) missense unknown
R7273:Pclo UTSW 5 14,731,608 (GRCm39) missense unknown
R7341:Pclo UTSW 5 14,725,850 (GRCm39) missense unknown
R7361:Pclo UTSW 5 14,843,882 (GRCm39) missense probably damaging 0.99
R7390:Pclo UTSW 5 14,732,024 (GRCm39) missense unknown
R7396:Pclo UTSW 5 14,589,902 (GRCm39) missense unknown
R7428:Pclo UTSW 5 14,800,531 (GRCm39) missense
R7448:Pclo UTSW 5 14,719,631 (GRCm39) missense unknown
R7476:Pclo UTSW 5 14,571,345 (GRCm39) missense probably damaging 1.00
R7483:Pclo UTSW 5 14,762,606 (GRCm39) missense
R7524:Pclo UTSW 5 14,728,317 (GRCm39) missense unknown
R7526:Pclo UTSW 5 14,571,076 (GRCm39) missense probably benign 0.11
R7537:Pclo UTSW 5 14,732,118 (GRCm39) missense unknown
R7597:Pclo UTSW 5 14,908,869 (GRCm39) missense unknown
R7597:Pclo UTSW 5 14,727,601 (GRCm39) missense unknown
R7605:Pclo UTSW 5 14,729,050 (GRCm39) missense unknown
R7646:Pclo UTSW 5 14,570,909 (GRCm39) missense probably damaging 1.00
R7685:Pclo UTSW 5 14,730,630 (GRCm39) missense unknown
R7879:Pclo UTSW 5 14,727,228 (GRCm39) missense unknown
R7885:Pclo UTSW 5 14,764,209 (GRCm39) frame shift probably null
R7885:Pclo UTSW 5 14,764,205 (GRCm39) frame shift probably null
R7885:Pclo UTSW 5 14,764,204 (GRCm39) frame shift probably null
R7887:Pclo UTSW 5 14,764,204 (GRCm39) frame shift probably null
R7921:Pclo UTSW 5 14,719,248 (GRCm39) missense unknown
R7948:Pclo UTSW 5 14,815,180 (GRCm39) nonsense probably null
R7970:Pclo UTSW 5 14,764,492 (GRCm39) missense
R8021:Pclo UTSW 5 14,589,798 (GRCm39) missense unknown
R8034:Pclo UTSW 5 14,571,214 (GRCm39) missense probably damaging 0.99
R8079:Pclo UTSW 5 14,590,472 (GRCm39) missense unknown
R8096:Pclo UTSW 5 14,762,975 (GRCm39) missense
R8182:Pclo UTSW 5 14,905,634 (GRCm39) missense unknown
R8188:Pclo UTSW 5 14,725,193 (GRCm39) missense unknown
R8218:Pclo UTSW 5 14,725,677 (GRCm39) missense unknown
R8288:Pclo UTSW 5 14,762,885 (GRCm39) missense
R8330:Pclo UTSW 5 14,725,311 (GRCm39) missense unknown
R8382:Pclo UTSW 5 14,727,080 (GRCm39) missense unknown
R8447:Pclo UTSW 5 14,731,423 (GRCm39) missense
R8491:Pclo UTSW 5 14,565,244 (GRCm39) missense unknown
R8506:Pclo UTSW 5 14,590,759 (GRCm39) missense unknown
R8524:Pclo UTSW 5 14,729,521 (GRCm39) unclassified probably benign
R8548:Pclo UTSW 5 14,732,268 (GRCm39) splice site probably null
R8670:Pclo UTSW 5 14,732,061 (GRCm39) missense unknown
R8691:Pclo UTSW 5 14,571,706 (GRCm39) missense unknown
R8719:Pclo UTSW 5 14,763,778 (GRCm39) nonsense probably null
R8743:Pclo UTSW 5 14,764,580 (GRCm39) missense
R8756:Pclo UTSW 5 14,764,398 (GRCm39) missense
R8829:Pclo UTSW 5 14,838,464 (GRCm39) missense
R8832:Pclo UTSW 5 14,838,464 (GRCm39) missense
R8912:Pclo UTSW 5 14,825,335 (GRCm39) missense
R8930:Pclo UTSW 5 14,762,989 (GRCm39) missense possibly damaging 0.95
R8932:Pclo UTSW 5 14,762,989 (GRCm39) missense possibly damaging 0.95
R8958:Pclo UTSW 5 14,763,056 (GRCm39) missense unknown
R8958:Pclo UTSW 5 14,725,369 (GRCm39) missense unknown
R8969:Pclo UTSW 5 14,572,208 (GRCm39) missense unknown
R8989:Pclo UTSW 5 14,719,325 (GRCm39) missense unknown
R8991:Pclo UTSW 5 14,719,325 (GRCm39) missense unknown
R8992:Pclo UTSW 5 14,719,325 (GRCm39) missense unknown
R8998:Pclo UTSW 5 14,727,510 (GRCm39) missense unknown
R9013:Pclo UTSW 5 14,727,627 (GRCm39) missense unknown
R9035:Pclo UTSW 5 14,763,192 (GRCm39) missense
R9060:Pclo UTSW 5 14,726,599 (GRCm39) missense unknown
R9122:Pclo UTSW 5 14,729,998 (GRCm39) missense unknown
R9164:Pclo UTSW 5 14,731,699 (GRCm39) missense
R9170:Pclo UTSW 5 14,731,068 (GRCm39) missense
R9192:Pclo UTSW 5 14,590,204 (GRCm39) missense unknown
R9203:Pclo UTSW 5 14,728,528 (GRCm39) missense unknown
R9245:Pclo UTSW 5 14,726,959 (GRCm39) missense unknown
R9260:Pclo UTSW 5 14,764,287 (GRCm39) missense unknown
R9336:Pclo UTSW 5 14,726,562 (GRCm39) missense unknown
R9378:Pclo UTSW 5 14,815,877 (GRCm39) missense
R9454:Pclo UTSW 5 14,762,452 (GRCm39) missense probably benign 0.01
R9462:Pclo UTSW 5 14,840,408 (GRCm39) missense
R9464:Pclo UTSW 5 14,816,830 (GRCm39) missense
R9474:Pclo UTSW 5 14,571,250 (GRCm39) missense possibly damaging 0.78
R9500:Pclo UTSW 5 14,725,648 (GRCm39) missense unknown
R9528:Pclo UTSW 5 14,727,691 (GRCm39) missense unknown
R9567:Pclo UTSW 5 14,763,436 (GRCm39) missense
R9569:Pclo UTSW 5 14,907,065 (GRCm39) critical splice donor site probably null
R9578:Pclo UTSW 5 14,816,753 (GRCm39) missense
R9647:Pclo UTSW 5 14,731,788 (GRCm39) missense
R9673:Pclo UTSW 5 14,908,758 (GRCm39) critical splice acceptor site probably null
R9691:Pclo UTSW 5 14,727,558 (GRCm39) missense unknown
R9706:Pclo UTSW 5 14,905,683 (GRCm39) missense unknown
R9803:Pclo UTSW 5 14,762,629 (GRCm39) missense
RF015:Pclo UTSW 5 14,565,283 (GRCm39) missense unknown
X0058:Pclo UTSW 5 14,732,145 (GRCm39) missense probably benign 0.23
Z1176:Pclo UTSW 5 14,762,662 (GRCm39) missense probably damaging 1.00
Z1176:Pclo UTSW 5 14,731,793 (GRCm39) missense
Z1176:Pclo UTSW 5 14,731,530 (GRCm39) missense possibly damaging 0.95
Z1177:Pclo UTSW 5 14,572,027 (GRCm39) missense possibly damaging 0.68
Z1177:Pclo UTSW 5 14,572,022 (GRCm39) missense probably damaging 0.99
Z1177:Pclo UTSW 5 14,728,170 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCAGCAGTGCAACTCTCTC -3'
(R):5'- TGCTACAGATTCTGTGATAGATGG -3'

Sequencing Primer
(F):5'- AGTGCAACTCTCTCTATCCCAGATG -3'
(R):5'- AGATTCTGTGATAGATGGTGCTATAC -3'
Posted On 2020-06-30