Incidental Mutation 'R8092:Tex101'
ID 629938
Institutional Source Beutler Lab
Gene Symbol Tex101
Ensembl Gene ENSMUSG00000062773
Gene Name testis expressed gene 101
Synonyms TES101RP, 1700008H15Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8092 (G1)
Quality Score 224.009
Status Validated
Chromosome 7
Chromosomal Location 24668007-24676675 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24670353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 62 (T62M)
Ref Sequence ENSEMBL: ENSMUSP00000077150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078001] [ENSMUST00000205488] [ENSMUST00000206390]
AlphaFold Q9JMI7
Predicted Effect probably damaging
Transcript: ENSMUST00000078001
AA Change: T62M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077150
Gene: ENSMUSG00000062773
AA Change: T62M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UPAR_LY6 141 217 3.9e-15 PFAM
low complexity region 232 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205488
AA Change: T62M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206390
AA Change: T62M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Male mice homozygous for a knockout allele of this marker are infertile due to the failure of sperm to migrate into the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dnajc3 A T 14: 118,970,582 probably null Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Dsg1c A G 18: 20,281,972 Y642C probably damaging Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Mettl11b A G 1: 163,717,250 Y55H probably damaging Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Ntn4 A C 10: 93,741,056 K529Q probably damaging Het
Olfr1308 C A 2: 111,960,307 M255I probably benign Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zbtb42 G T 12: 112,679,841 C150F probably damaging Het
Other mutations in Tex101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Tex101 APN 7 24668325 missense probably damaging 1.00
IGL03007:Tex101 APN 7 24670481 splice site probably benign
IGL03357:Tex101 APN 7 24668333 missense probably damaging 0.96
R1935:Tex101 UTSW 7 24668225 missense probably benign 0.33
R1936:Tex101 UTSW 7 24668225 missense probably benign 0.33
R4632:Tex101 UTSW 7 24668368 nonsense probably null
R6109:Tex101 UTSW 7 24668313 missense possibly damaging 0.79
R7049:Tex101 UTSW 7 24668258 missense probably benign 0.03
R7276:Tex101 UTSW 7 24670404 missense probably damaging 1.00
R7860:Tex101 UTSW 7 24669765 missense probably damaging 1.00
R8435:Tex101 UTSW 7 24668366 missense probably damaging 1.00
R8514:Tex101 UTSW 7 24668532 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCATCTTTATTGCCACGGGG -3'
(R):5'- CTGTAGGAAATGACTGGCTCAC -3'

Sequencing Primer
(F):5'- TTAGCTATAAACACAGATCAGTGGG -3'
(R):5'- TGGCTCACAGAGGGTACTG -3'
Posted On 2020-06-30