Incidental Mutation 'R0701:Ddx31'
ID 62994
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 038884-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R0701 (G1)
Quality Score 203
Status Not validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 28748789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 239 (R239L)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably null
Transcript: ENSMUST00000113853
AA Change: R239L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: R239L

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152685
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,571,995 (GRCm39) V261A probably benign Het
Arhgef10 T A 8: 15,012,636 (GRCm39) V320E probably damaging Het
Arhgef11 G T 3: 87,640,766 (GRCm39) A1308S probably benign Het
Bach1 G A 16: 87,516,877 (GRCm39) E473K probably damaging Het
Bsph1 G T 7: 13,206,181 (GRCm39) C72F probably damaging Het
C2cd2l A G 9: 44,227,499 (GRCm39) L186P probably damaging Het
C9 A C 15: 6,496,902 (GRCm39) T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,723,108 (GRCm39) probably null Het
Chd1 C A 17: 15,945,693 (GRCm39) N72K probably benign Het
Copg1 T A 6: 87,871,089 (GRCm39) Y268* probably null Het
Csad A G 15: 102,087,571 (GRCm39) S331P probably benign Het
Fat1 G T 8: 45,479,590 (GRCm39) A2879S probably benign Het
Fig4 T A 10: 41,116,508 (GRCm39) R628* probably null Het
Fmnl3 T C 15: 99,219,188 (GRCm39) N778S probably damaging Het
Gm10912 T C 2: 103,896,875 (GRCm39) S5P probably benign Het
Haus3 G A 5: 34,323,359 (GRCm39) T417M probably benign Het
Herc1 T G 9: 66,395,232 (GRCm39) V4189G probably damaging Het
Hoxb3 C A 11: 96,237,074 (GRCm39) S384* probably null Het
Ifnar2 A G 16: 91,201,117 (GRCm39) T453A possibly damaging Het
Ift140 A G 17: 25,309,907 (GRCm39) T1105A probably benign Het
Kmt2e T C 5: 23,678,581 (GRCm39) V220A probably benign Het
Lrriq1 A T 10: 103,069,905 (GRCm39) V37E probably benign Het
Lrrn4 G A 2: 132,712,080 (GRCm39) T581M probably benign Het
Mcur1 T C 13: 43,699,216 (GRCm39) Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 (GRCm39) D1313E probably benign Het
Med13 T A 11: 86,197,864 (GRCm39) T736S probably benign Het
Mlh3 A T 12: 85,314,677 (GRCm39) I503K probably benign Het
Nckap5 A G 1: 125,953,094 (GRCm39) F1089L probably benign Het
Or1e35 A T 11: 73,797,655 (GRCm39) I221N probably damaging Het
Or4c10 A G 2: 89,760,545 (GRCm39) T131A probably benign Het
Or4k48 C T 2: 111,476,136 (GRCm39) V69I probably benign Het
Pdgfd A T 9: 6,359,706 (GRCm39) D259V probably damaging Het
Pramel22 C T 4: 143,383,010 (GRCm39) E70K possibly damaging Het
R3hdm1 A G 1: 128,109,476 (GRCm39) Y309C probably damaging Het
Rab27b A T 18: 70,118,270 (GRCm39) C216S probably damaging Het
Robo2 A G 16: 73,843,762 (GRCm39) I151T probably damaging Het
Sh2d4a A G 8: 68,783,747 (GRCm39) D227G probably damaging Het
Sis G T 3: 72,848,378 (GRCm39) T632K probably damaging Het
Smcr8 T C 11: 60,668,941 (GRCm39) Y30H probably damaging Het
Stap1 T C 5: 86,242,667 (GRCm39) probably null Het
Syt16 G A 12: 74,281,886 (GRCm39) V337I probably benign Het
Taf1c A T 8: 120,326,722 (GRCm39) I438N probably damaging Het
Ttn A G 2: 76,728,412 (GRCm39) probably benign Het
Unc45b T A 11: 82,831,031 (GRCm39) L797Q possibly damaging Het
Usp6nl A G 2: 6,419,829 (GRCm39) E144G possibly damaging Het
Wiz A T 17: 32,575,415 (GRCm39) I907N probably damaging Het
Zap70 G A 1: 36,820,258 (GRCm39) R513Q probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGGGGCTCATGTGGCATATAC -3'
(R):5'- TGCCCGGTGCAAAGAGGAAATC -3'

Sequencing Primer
(F):5'- cagaaggcagaggcagatag -3'
(R):5'- AGGAAATCTGATACTACCAGGC -3'
Posted On 2013-07-30