Incidental Mutation 'R8092:Ntn4'
ID 629946
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8092 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 93741056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 529 (K529Q)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
AlphaFold Q9JI33
Predicted Effect probably damaging
Transcript: ENSMUST00000020204
AA Change: K529Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: K529Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dnajc3 A T 14: 118,970,582 probably null Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Dsg1c A G 18: 20,281,972 Y642C probably damaging Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Mettl11b A G 1: 163,717,250 Y55H probably damaging Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Olfr1308 C A 2: 111,960,307 M255I probably benign Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Tex101 G A 7: 24,670,353 T62M probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zbtb42 G T 12: 112,679,841 C150F probably damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCAAGGGTGAATGAGC -3'
(R):5'- TATAACAGAAGACAGCCAATGTGC -3'

Sequencing Primer
(F):5'- GCCTCATGACCTTAAAAGCAGGTTTC -3'
(R):5'- ATGGAAAGTCTAACCGGTCTC -3'
Posted On 2020-06-30