Incidental Mutation 'R8092:Dsg1c'
ID629960
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8092 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20281972 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 642 (Y642C)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: Y642C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: Y642C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Mettl11b A G 1: 163,717,250 Y55H probably damaging Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Ntn4 A C 10: 93,741,056 K529Q probably damaging Het
Olfr1308 C A 2: 111,960,307 M255I probably benign Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Tex101 G A 7: 24,670,353 T62M probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zbtb42 G T 12: 112,679,841 C150F probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20274767 missense probably damaging 1.00
R8103:Dsg1c UTSW 18 20283114 missense probably damaging 1.00
R8117:Dsg1c UTSW 18 20276959 missense probably benign
R8192:Dsg1c UTSW 18 20266198 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20283573 missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20264949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAACCATGCATACTTGAATG -3'
(R):5'- TCATGAAGAATAGCTTGGCGG -3'

Sequencing Primer
(F):5'- ACCATGCATACTTGAATGAAGAAAC -3'
(R):5'- CCTTACCTGGCAGAAGTA -3'
Posted On2020-06-30