Mutagenetix > Incidental Mutation

Incidental Mutation 'R8093:Atrn'

629973

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8093 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130975988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 821 (F821L)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably benign
Transcript: ENSMUST00000028781
AA Change: F821L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F821L

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.2%
20x: 98.3%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	T	16: 4,851,504	T745S	possibly damaging	Het
Abca12	T	C	1: 71,280,393	I1777V	probably benign	Het
Abhd6	T	C	14: 8,028,353	L28P	probably damaging	Het
Angpt1	T	A	15: 42,476,477	E279D	probably benign	Het
Arfgef2	A	G	2: 166,894,657	M1750V	probably benign	Het
Cbx3	A	G	6: 51,481,768	E71G	possibly damaging	Het
Ccdc14	G	A	16: 34,709,652	A482T	probably damaging	Het
Cdh15	G	T	8: 122,866,835	A723S	probably damaging	Het
Cyp2a12	A	G	7: 27,036,629	S488G	probably damaging	Het
Ddx55	C	A	5: 124,556,820	H104N	possibly damaging	Het
Det1	G	T	7: 78,843,509	T249N	possibly damaging	Het
Disp3	A	G	4: 148,270,516	S348P	possibly damaging	Het
Dnah6	T	G	6: 73,160,913	N936T	probably damaging	Het
Dnajc11	A	T	4: 151,969,900	N188Y	probably damaging	Het
Etaa1	G	A	11: 17,947,559	T186I	possibly damaging	Het
Fam160a1	T	C	3: 85,672,804	D698G	probably benign	Het
Ftl1-ps1	T	A	13: 74,407,019	V139E	probably benign	Het
Fzd10	A	G	5: 128,602,239	K341R	probably benign	Het
Galnt7	A	G	8: 57,532,705	Y544H	probably benign	Het
Gm11487	A	T	4: 73,403,522	V92E	probably damaging	Het
Gm21190	T	A	5: 15,525,816	I181F	possibly damaging	Het
Gm3604	T	C	13: 62,369,549	N332D	probably damaging	Het
Gm47996	G	T	1: 151,210,304	E45D	possibly damaging	Het
Gm5475	T	A	15: 100,424,012	L14Q	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr182	T	C	10: 127,750,914	Y56C	probably damaging	Het
Gxylt2	T	A	6: 100,733,227	W110R	probably damaging	Het
Hivep3	G	T	4: 120,095,435	R316L	possibly damaging	Het
Hnf1a	T	C	5: 114,955,277	T310A	probably benign	Het
Igkv6-32	A	G	6: 70,074,563	F8L	probably benign	Het
Kcnq1	A	G	7: 143,362,652	N550D	probably damaging	Het
Lrrc40	T	G	3: 158,051,782	Y249*	probably null	Het
Lrrc43	T	A	5: 123,501,129	M407K	probably benign	Het
Map2k6	A	C	11: 110,482,585	E21D	probably benign	Het
Mcoln1	T	A	8: 3,508,740	I246N	possibly damaging	Het
Myh2	A	G	11: 67,188,710	K998E	probably damaging	Het
Myo1b	C	T	1: 51,757,875		probably null	Het
Numbl	T	A	7: 27,281,036	M481K	possibly damaging	Het
Nxpe4	G	T	9: 48,396,552	V319F	probably benign	Het
Pam	C	A	1: 97,885,632	D358Y	probably damaging	Het
Papola	A	G	12: 105,809,577	M251V	probably damaging	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Prelid2	A	G	18: 41,932,635	S112P	probably damaging	Het
Ptgfrn	T	C	3: 101,056,437	T620A	probably benign	Het
Ptgfrn	C	T	3: 101,072,941	R361Q	probably benign	Het
Pygm	T	A	19: 6,386,042	M148K	probably damaging	Het
Ren1	T	A	1: 133,360,074	I382N	probably damaging	Het
Rev1	T	C	1: 38,075,016		probably benign	Het
Sdsl	T	C	5: 120,459,952	K159E	probably benign	Het
Serinc4	T	C	2: 121,454,953	N203S	possibly damaging	Het
Slc12a2	A	G	18: 57,879,351	H182R	probably benign	Het
Sned1	C	A	1: 93,274,665	T677K	possibly damaging	Het
Ston2	G	A	12: 91,743,686	T3I	probably damaging	Het
Tnf	T	C	17: 35,201,096	T77A	probably benign	Het
Trav6-2	G	A	14: 52,667,669	G49E	probably benign	Het
Trav7-4	A	T	14: 53,461,683	I96F	probably damaging	Het
Trmu	T	A	15: 85,882,720	D43E	probably benign	Het
Uggt1	T	A	1: 36,227,485	Q136L	probably damaging	Het
Ugt1a5	T	A	1: 88,166,582	Y177*	probably null	Het
Vmn1r126	T	C	7: 21,300,591	R293G	probably damaging	Het
Vmn2r89	A	G	14: 51,456,242	I350V	probably benign	Het
Vps11	A	T	9: 44,356,232	L361Q	probably damaging	Het
Zfp467	A	G	6: 48,443,432	L5P	possibly damaging	Het
Zfp652	A	G	11: 95,749,462	H71R	probably damaging	Het
Zfp804b	T	C	5: 6,770,082	K994E	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGGATGAGTTCAGATGTTCAG -3'
(R):5'- CTGATGTCACCAGAATATGTACAC -3'

Sequencing Primer
(F):5'- ATTTTGAACTAGTAAACCGAACTGC -3'
(R):5'- AGGTATCAAAAGAAGAGCCTCTG -3'

Posted On

2020-06-30