Incidental Mutation 'R8093:Atrn'
ID 629973
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 067525-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130817908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 821 (F821L)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: F821L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F821L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,669,368 (GRCm39) T745S possibly damaging Het
Abca12 T C 1: 71,319,552 (GRCm39) I1777V probably benign Het
Abhd6 T C 14: 8,028,353 (GRCm38) L28P probably damaging Het
Angpt1 T A 15: 42,339,873 (GRCm39) E279D probably benign Het
Arfgef2 A G 2: 166,736,577 (GRCm39) M1750V probably benign Het
Cbx3 A G 6: 51,458,748 (GRCm39) E71G possibly damaging Het
Ccdc14 G A 16: 34,530,022 (GRCm39) A482T probably damaging Het
Cdh15 G T 8: 123,593,574 (GRCm39) A723S probably damaging Het
Cyp2a12 A G 7: 26,736,054 (GRCm39) S488G probably damaging Het
Ddx55 C A 5: 124,694,883 (GRCm39) H104N possibly damaging Het
Det1 G T 7: 78,493,257 (GRCm39) T249N possibly damaging Het
Disp3 A G 4: 148,354,973 (GRCm39) S348P possibly damaging Het
Dnah6 T G 6: 73,137,896 (GRCm39) N936T probably damaging Het
Dnajc11 A T 4: 152,054,357 (GRCm39) N188Y probably damaging Het
Etaa1 G A 11: 17,897,559 (GRCm39) T186I possibly damaging Het
Fhip1a T C 3: 85,580,111 (GRCm39) D698G probably benign Het
Ftl1-ps1 T A 13: 74,555,138 (GRCm39) V139E probably benign Het
Fzd10 A G 5: 128,679,303 (GRCm39) K341R probably benign Het
Galnt7 A G 8: 57,985,739 (GRCm39) Y544H probably benign Het
Gm21190 T A 5: 15,730,814 (GRCm39) I181F possibly damaging Het
Gm3604 T C 13: 62,517,363 (GRCm39) N332D probably damaging Het
Gm47996 G T 1: 151,086,055 (GRCm39) E45D possibly damaging Het
Gm5475 T A 15: 100,321,893 (GRCm39) L14Q unknown Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr182 T C 10: 127,586,783 (GRCm39) Y56C probably damaging Het
Gxylt2 T A 6: 100,710,188 (GRCm39) W110R probably damaging Het
Hivep3 G T 4: 119,952,632 (GRCm39) R316L possibly damaging Het
Hnf1a T C 5: 115,093,336 (GRCm39) T310A probably benign Het
Igkv6-32 A G 6: 70,051,547 (GRCm39) F8L probably benign Het
Kcnq1 A G 7: 142,916,389 (GRCm39) N550D probably damaging Het
Lrrc40 T G 3: 157,757,419 (GRCm39) Y249* probably null Het
Lrrc43 T A 5: 123,639,192 (GRCm39) M407K probably benign Het
Map2k6 A C 11: 110,373,411 (GRCm39) E21D probably benign Het
Mcoln1 T A 8: 3,558,740 (GRCm39) I246N possibly damaging Het
Msantd5f6 A T 4: 73,321,759 (GRCm39) V92E probably damaging Het
Myh2 A G 11: 67,079,536 (GRCm39) K998E probably damaging Het
Myo1b C T 1: 51,797,034 (GRCm39) probably null Het
Numbl T A 7: 26,980,461 (GRCm39) M481K possibly damaging Het
Nxpe4 G T 9: 48,307,852 (GRCm39) V319F probably benign Het
Pam C A 1: 97,813,357 (GRCm39) D358Y probably damaging Het
Papola A G 12: 105,775,836 (GRCm39) M251V probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Prelid2 A G 18: 42,065,700 (GRCm39) S112P probably damaging Het
Ptgfrn T C 3: 100,963,753 (GRCm39) T620A probably benign Het
Ptgfrn C T 3: 100,980,257 (GRCm39) R361Q probably benign Het
Pygm T A 19: 6,436,072 (GRCm39) M148K probably damaging Het
Ren1 T A 1: 133,287,812 (GRCm39) I382N probably damaging Het
Rev1 T C 1: 38,114,097 (GRCm39) probably benign Het
Sdsl T C 5: 120,598,017 (GRCm39) K159E probably benign Het
Serinc4 T C 2: 121,285,434 (GRCm39) N203S possibly damaging Het
Slc12a2 A G 18: 58,012,423 (GRCm39) H182R probably benign Het
Sned1 C A 1: 93,202,387 (GRCm39) T677K possibly damaging Het
Ston2 G A 12: 91,710,460 (GRCm39) T3I probably damaging Het
Tnf T C 17: 35,420,072 (GRCm39) T77A probably benign Het
Trav6-2 G A 14: 52,905,126 (GRCm39) G49E probably benign Het
Trav7-4 A T 14: 53,699,140 (GRCm39) I96F probably damaging Het
Trmu T A 15: 85,766,921 (GRCm39) D43E probably benign Het
Uggt1 T A 1: 36,266,566 (GRCm39) Q136L probably damaging Het
Ugt1a5 T A 1: 88,094,304 (GRCm39) Y177* probably null Het
Vmn1r126 T C 7: 21,034,516 (GRCm39) R293G probably damaging Het
Vmn2r89 A G 14: 51,693,699 (GRCm39) I350V probably benign Het
Vps11 A T 9: 44,267,529 (GRCm39) L361Q probably damaging Het
Zfp467 A G 6: 48,420,366 (GRCm39) L5P possibly damaging Het
Zfp652 A G 11: 95,640,288 (GRCm39) H71R probably damaging Het
Zfp804b T C 5: 6,820,082 (GRCm39) K994E probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGATGAGTTCAGATGTTCAG -3'
(R):5'- CTGATGTCACCAGAATATGTACAC -3'

Sequencing Primer
(F):5'- ATTTTGAACTAGTAAACCGAACTGC -3'
(R):5'- AGGTATCAAAAGAAGAGCCTCTG -3'
Posted On 2020-06-30