Mutagenetix > Incidental Mutation

Incidental Mutation 'R8093:Ptgfrn'

629976

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

067525-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8093 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101056437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 620 (T620A)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably benign
Transcript: ENSMUST00000102694
AA Change: T620A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: T620A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.2%
20x: 98.3%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	T	16: 4,851,504	T745S	possibly damaging	Het
Abca12	T	C	1: 71,280,393	I1777V	probably benign	Het
Abhd6	T	C	14: 8,028,353	L28P	probably damaging	Het
Angpt1	T	A	15: 42,476,477	E279D	probably benign	Het
Arfgef2	A	G	2: 166,894,657	M1750V	probably benign	Het
Atrn	T	C	2: 130,975,988	F821L	probably benign	Het
Cbx3	A	G	6: 51,481,768	E71G	possibly damaging	Het
Ccdc14	G	A	16: 34,709,652	A482T	probably damaging	Het
Cdh15	G	T	8: 122,866,835	A723S	probably damaging	Het
Cyp2a12	A	G	7: 27,036,629	S488G	probably damaging	Het
Ddx55	C	A	5: 124,556,820	H104N	possibly damaging	Het
Det1	G	T	7: 78,843,509	T249N	possibly damaging	Het
Disp3	A	G	4: 148,270,516	S348P	possibly damaging	Het
Dnah6	T	G	6: 73,160,913	N936T	probably damaging	Het
Dnajc11	A	T	4: 151,969,900	N188Y	probably damaging	Het
Etaa1	G	A	11: 17,947,559	T186I	possibly damaging	Het
Fam160a1	T	C	3: 85,672,804	D698G	probably benign	Het
Ftl1-ps1	T	A	13: 74,407,019	V139E	probably benign	Het
Fzd10	A	G	5: 128,602,239	K341R	probably benign	Het
Galnt7	A	G	8: 57,532,705	Y544H	probably benign	Het
Gm11487	A	T	4: 73,403,522	V92E	probably damaging	Het
Gm21190	T	A	5: 15,525,816	I181F	possibly damaging	Het
Gm3604	T	C	13: 62,369,549	N332D	probably damaging	Het
Gm47996	G	T	1: 151,210,304	E45D	possibly damaging	Het
Gm5475	T	A	15: 100,424,012	L14Q	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr182	T	C	10: 127,750,914	Y56C	probably damaging	Het
Gxylt2	T	A	6: 100,733,227	W110R	probably damaging	Het
Hivep3	G	T	4: 120,095,435	R316L	possibly damaging	Het
Hnf1a	T	C	5: 114,955,277	T310A	probably benign	Het
Igkv6-32	A	G	6: 70,074,563	F8L	probably benign	Het
Kcnq1	A	G	7: 143,362,652	N550D	probably damaging	Het
Lrrc40	T	G	3: 158,051,782	Y249*	probably null	Het
Lrrc43	T	A	5: 123,501,129	M407K	probably benign	Het
Map2k6	A	C	11: 110,482,585	E21D	probably benign	Het
Mcoln1	T	A	8: 3,508,740	I246N	possibly damaging	Het
Myh2	A	G	11: 67,188,710	K998E	probably damaging	Het
Myo1b	C	T	1: 51,757,875		probably null	Het
Numbl	T	A	7: 27,281,036	M481K	possibly damaging	Het
Nxpe4	G	T	9: 48,396,552	V319F	probably benign	Het
Pam	C	A	1: 97,885,632	D358Y	probably damaging	Het
Papola	A	G	12: 105,809,577	M251V	probably damaging	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Prelid2	A	G	18: 41,932,635	S112P	probably damaging	Het
Pygm	T	A	19: 6,386,042	M148K	probably damaging	Het
Ren1	T	A	1: 133,360,074	I382N	probably damaging	Het
Rev1	T	C	1: 38,075,016		probably benign	Het
Sdsl	T	C	5: 120,459,952	K159E	probably benign	Het
Serinc4	T	C	2: 121,454,953	N203S	possibly damaging	Het
Slc12a2	A	G	18: 57,879,351	H182R	probably benign	Het
Sned1	C	A	1: 93,274,665	T677K	possibly damaging	Het
Ston2	G	A	12: 91,743,686	T3I	probably damaging	Het
Tnf	T	C	17: 35,201,096	T77A	probably benign	Het
Trav6-2	G	A	14: 52,667,669	G49E	probably benign	Het
Trav7-4	A	T	14: 53,461,683	I96F	probably damaging	Het
Trmu	T	A	15: 85,882,720	D43E	probably benign	Het
Uggt1	T	A	1: 36,227,485	Q136L	probably damaging	Het
Ugt1a5	T	A	1: 88,166,582	Y177*	probably null	Het
Vmn1r126	T	C	7: 21,300,591	R293G	probably damaging	Het
Vmn2r89	A	G	14: 51,456,242	I350V	probably benign	Het
Vps11	A	T	9: 44,356,232	L361Q	probably damaging	Het
Zfp467	A	G	6: 48,443,432	L5P	possibly damaging	Het
Zfp652	A	G	11: 95,749,462	H71R	probably damaging	Het
Zfp804b	T	C	5: 6,770,082	K994E	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGATTGGAGAGACTGGTCGC -3'
(R):5'- ATTCCAGATTCTGTGCTCGTG -3'

Sequencing Primer
(F):5'- AGACTGGTCGCTGCCTCTC -3'
(R):5'- AAAGCCTTTCTTTGCTGCAGG -3'

Posted On

2020-06-30