Incidental Mutation 'R8093:Ddx55'
ID 629988
Institutional Source Beutler Lab
Gene Symbol Ddx55
Ensembl Gene ENSMUSG00000029389
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms 2810021H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124552864-124569660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 124556820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 104 (H104N)
Ref Sequence ENSEMBL: ENSMUSP00000070279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071057] [ENSMUST00000111438] [ENSMUST00000131631]
AlphaFold Q6ZPL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000071057
AA Change: H104N

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070279
Gene: ENSMUSG00000029389
AA Change: H104N

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 402 465 1.44e-26 SMART
low complexity region 491 506 N/A INTRINSIC
low complexity region 517 540 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111438
AA Change: H104N

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107065
Gene: ENSMUSG00000029389
AA Change: H104N

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 398 461 1.44e-26 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131631
SMART Domains Protein: ENSMUSP00000143462
Gene: ENSMUSG00000029389

DomainStartEndE-ValueType
Pfam:DEAD 33 125 6.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Cyp2a12 A G 7: 27,036,629 S488G probably damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Map2k6 A C 11: 110,482,585 E21D probably benign Het
Mcoln1 T A 8: 3,508,740 I246N possibly damaging Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Slc12a2 A G 18: 57,879,351 H182R probably benign Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Ddx55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Ddx55 APN 5 124567895 missense probably damaging 1.00
IGL03356:Ddx55 APN 5 124554753 missense possibly damaging 0.95
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0329:Ddx55 UTSW 5 124559147 missense probably benign 0.00
R0401:Ddx55 UTSW 5 124567951 missense probably damaging 1.00
R1604:Ddx55 UTSW 5 124559306 missense probably damaging 1.00
R1760:Ddx55 UTSW 5 124568113 missense probably damaging 0.99
R2002:Ddx55 UTSW 5 124566440 missense probably damaging 1.00
R2292:Ddx55 UTSW 5 124568077 missense probably benign 0.00
R4677:Ddx55 UTSW 5 124567934 missense probably benign 0.04
R4735:Ddx55 UTSW 5 124566476 missense probably damaging 1.00
R4745:Ddx55 UTSW 5 124566965 nonsense probably null
R4941:Ddx55 UTSW 5 124568716 nonsense probably null
R5272:Ddx55 UTSW 5 124558029 missense possibly damaging 0.91
R5348:Ddx55 UTSW 5 124554565 missense probably damaging 0.96
R5514:Ddx55 UTSW 5 124556812 missense probably damaging 1.00
R5801:Ddx55 UTSW 5 124566497 critical splice donor site probably null
R5806:Ddx55 UTSW 5 124559199 missense probably damaging 1.00
R5869:Ddx55 UTSW 5 124568682 missense probably benign
R5909:Ddx55 UTSW 5 124566850 missense probably benign 0.00
R6594:Ddx55 UTSW 5 124566925 missense probably damaging 1.00
R6737:Ddx55 UTSW 5 124552945 missense probably damaging 1.00
R7257:Ddx55 UTSW 5 124560721 missense possibly damaging 0.67
R7262:Ddx55 UTSW 5 124566856 missense probably benign
R8049:Ddx55 UTSW 5 124556758 missense probably damaging 0.96
R8078:Ddx55 UTSW 5 124566388 missense probably damaging 1.00
R8465:Ddx55 UTSW 5 124559121 splice site probably null
R8944:Ddx55 UTSW 5 124568725 missense probably damaging 0.98
R9007:Ddx55 UTSW 5 124559307 missense probably damaging 0.99
R9305:Ddx55 UTSW 5 124566949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTTCTGCCTCTGAGCTG -3'
(R):5'- ACATCTTCTCCAGGGTTCCG -3'

Sequencing Primer
(F):5'- CAAAGCTCTTGATTTGCTGAGACCG -3'
(R):5'- AGGGTTCCGGCCTCCAATC -3'
Posted On 2020-06-30