Incidental Mutation 'R8093:Gmcl1'
ID629994
Institutional Source Beutler Lab
Gene Symbol Gmcl1
Ensembl Gene ENSMUSG00000001157
Gene Namegerm cell-less, spermatogenesis associated 1
SynonymsGcl, mglc-1, 2810049L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R8093 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location86691768-86733383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86721426 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 163 (A163E)
Ref Sequence ENSEMBL: ENSMUSP00000001185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001185] [ENSMUST00000113679]
Predicted Effect probably damaging
Transcript: ENSMUST00000001185
AA Change: A163E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157
AA Change: A163E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
BTB 106 206 3.76e-11 SMART
BACK 211 298 3.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113679
AA Change: A163E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109309
Gene: ENSMUSG00000001157
AA Change: A163E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
Pfam:BTB 96 195 5.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Cyp2a12 A G 7: 27,036,629 S488G probably damaging Het
Ddx55 C A 5: 124,556,820 H104N possibly damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Map2k6 A C 11: 110,482,585 E21D probably benign Het
Mcoln1 T A 8: 3,508,740 I246N possibly damaging Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Slc12a2 A G 18: 57,879,351 H182R probably benign Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Gmcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Gmcl1 APN 6 86707457 missense possibly damaging 0.52
IGL03354:Gmcl1 APN 6 86726158 missense probably damaging 1.00
PIT4453001:Gmcl1 UTSW 6 86704538 missense probably benign 0.09
R0149:Gmcl1 UTSW 6 86732909 critical splice donor site probably null
R1398:Gmcl1 UTSW 6 86714262 splice site probably benign
R1869:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R1871:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R2851:Gmcl1 UTSW 6 86726177 missense probably damaging 0.99
R4584:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4585:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4664:Gmcl1 UTSW 6 86732998 missense probably benign 0.30
R4851:Gmcl1 UTSW 6 86704556 missense possibly damaging 0.64
R4957:Gmcl1 UTSW 6 86710521 missense probably damaging 1.00
R5326:Gmcl1 UTSW 6 86726145 missense possibly damaging 0.96
R5482:Gmcl1 UTSW 6 86718073 missense probably damaging 1.00
R5496:Gmcl1 UTSW 6 86697525 missense probably damaging 0.97
R5817:Gmcl1 UTSW 6 86714248 missense probably damaging 1.00
R5854:Gmcl1 UTSW 6 86714259 splice site silent
R5891:Gmcl1 UTSW 6 86707443 missense probably damaging 1.00
R5895:Gmcl1 UTSW 6 86711614 missense probably benign 0.03
R6012:Gmcl1 UTSW 6 86721412 missense probably damaging 1.00
R6257:Gmcl1 UTSW 6 86700641 missense possibly damaging 0.82
R7693:Gmcl1 UTSW 6 86714257 missense probably benign 0.10
R7698:Gmcl1 UTSW 6 86707415 missense probably benign 0.00
R7999:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8049:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8109:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8110:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8111:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8154:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8157:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8208:Gmcl1 UTSW 6 86721399 missense probably damaging 0.99
R8250:Gmcl1 UTSW 6 86721402 missense possibly damaging 0.72
R8509:Gmcl1 UTSW 6 86722607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCAGTTCACACAGTGATC -3'
(R):5'- GGCAGAATCCTTTCCAACAAG -3'

Sequencing Primer
(F):5'- GTTCACACAGTGATCAAAGACCTTC -3'
(R):5'- GCAGAATCCTTTCCAACAAGCAATG -3'
Posted On2020-06-30