Incidental Mutation 'R8093:Cyp2a12'
ID 629997
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
MMRRC Submission 067525-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26728515-26736243 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26736054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 488 (S488G)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably damaging
Transcript: ENSMUST00000075552
AA Change: S488G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: S488G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,669,368 (GRCm39) T745S possibly damaging Het
Abca12 T C 1: 71,319,552 (GRCm39) I1777V probably benign Het
Abhd6 T C 14: 8,028,353 (GRCm38) L28P probably damaging Het
Angpt1 T A 15: 42,339,873 (GRCm39) E279D probably benign Het
Arfgef2 A G 2: 166,736,577 (GRCm39) M1750V probably benign Het
Atrn T C 2: 130,817,908 (GRCm39) F821L probably benign Het
Cbx3 A G 6: 51,458,748 (GRCm39) E71G possibly damaging Het
Ccdc14 G A 16: 34,530,022 (GRCm39) A482T probably damaging Het
Cdh15 G T 8: 123,593,574 (GRCm39) A723S probably damaging Het
Ddx55 C A 5: 124,694,883 (GRCm39) H104N possibly damaging Het
Det1 G T 7: 78,493,257 (GRCm39) T249N possibly damaging Het
Disp3 A G 4: 148,354,973 (GRCm39) S348P possibly damaging Het
Dnah6 T G 6: 73,137,896 (GRCm39) N936T probably damaging Het
Dnajc11 A T 4: 152,054,357 (GRCm39) N188Y probably damaging Het
Etaa1 G A 11: 17,897,559 (GRCm39) T186I possibly damaging Het
Fhip1a T C 3: 85,580,111 (GRCm39) D698G probably benign Het
Ftl1-ps1 T A 13: 74,555,138 (GRCm39) V139E probably benign Het
Fzd10 A G 5: 128,679,303 (GRCm39) K341R probably benign Het
Galnt7 A G 8: 57,985,739 (GRCm39) Y544H probably benign Het
Gm21190 T A 5: 15,730,814 (GRCm39) I181F possibly damaging Het
Gm3604 T C 13: 62,517,363 (GRCm39) N332D probably damaging Het
Gm47996 G T 1: 151,086,055 (GRCm39) E45D possibly damaging Het
Gm5475 T A 15: 100,321,893 (GRCm39) L14Q unknown Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr182 T C 10: 127,586,783 (GRCm39) Y56C probably damaging Het
Gxylt2 T A 6: 100,710,188 (GRCm39) W110R probably damaging Het
Hivep3 G T 4: 119,952,632 (GRCm39) R316L possibly damaging Het
Hnf1a T C 5: 115,093,336 (GRCm39) T310A probably benign Het
Igkv6-32 A G 6: 70,051,547 (GRCm39) F8L probably benign Het
Kcnq1 A G 7: 142,916,389 (GRCm39) N550D probably damaging Het
Lrrc40 T G 3: 157,757,419 (GRCm39) Y249* probably null Het
Lrrc43 T A 5: 123,639,192 (GRCm39) M407K probably benign Het
Map2k6 A C 11: 110,373,411 (GRCm39) E21D probably benign Het
Mcoln1 T A 8: 3,558,740 (GRCm39) I246N possibly damaging Het
Msantd5f6 A T 4: 73,321,759 (GRCm39) V92E probably damaging Het
Myh2 A G 11: 67,079,536 (GRCm39) K998E probably damaging Het
Myo1b C T 1: 51,797,034 (GRCm39) probably null Het
Numbl T A 7: 26,980,461 (GRCm39) M481K possibly damaging Het
Nxpe4 G T 9: 48,307,852 (GRCm39) V319F probably benign Het
Pam C A 1: 97,813,357 (GRCm39) D358Y probably damaging Het
Papola A G 12: 105,775,836 (GRCm39) M251V probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Prelid2 A G 18: 42,065,700 (GRCm39) S112P probably damaging Het
Ptgfrn T C 3: 100,963,753 (GRCm39) T620A probably benign Het
Ptgfrn C T 3: 100,980,257 (GRCm39) R361Q probably benign Het
Pygm T A 19: 6,436,072 (GRCm39) M148K probably damaging Het
Ren1 T A 1: 133,287,812 (GRCm39) I382N probably damaging Het
Rev1 T C 1: 38,114,097 (GRCm39) probably benign Het
Sdsl T C 5: 120,598,017 (GRCm39) K159E probably benign Het
Serinc4 T C 2: 121,285,434 (GRCm39) N203S possibly damaging Het
Slc12a2 A G 18: 58,012,423 (GRCm39) H182R probably benign Het
Sned1 C A 1: 93,202,387 (GRCm39) T677K possibly damaging Het
Ston2 G A 12: 91,710,460 (GRCm39) T3I probably damaging Het
Tnf T C 17: 35,420,072 (GRCm39) T77A probably benign Het
Trav6-2 G A 14: 52,905,126 (GRCm39) G49E probably benign Het
Trav7-4 A T 14: 53,699,140 (GRCm39) I96F probably damaging Het
Trmu T A 15: 85,766,921 (GRCm39) D43E probably benign Het
Uggt1 T A 1: 36,266,566 (GRCm39) Q136L probably damaging Het
Ugt1a5 T A 1: 88,094,304 (GRCm39) Y177* probably null Het
Vmn1r126 T C 7: 21,034,516 (GRCm39) R293G probably damaging Het
Vmn2r89 A G 14: 51,693,699 (GRCm39) I350V probably benign Het
Vps11 A T 9: 44,267,529 (GRCm39) L361Q probably damaging Het
Zfp467 A G 6: 48,420,366 (GRCm39) L5P possibly damaging Het
Zfp652 A G 11: 95,640,288 (GRCm39) H71R probably damaging Het
Zfp804b T C 5: 6,820,082 (GRCm39) K994E probably benign Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 26,736,036 (GRCm39) missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 26,732,008 (GRCm39) missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 26,730,583 (GRCm39) missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 26,731,967 (GRCm39) missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 26,730,631 (GRCm39) missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 26,729,017 (GRCm39) missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 26,734,198 (GRCm39) missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 26,734,198 (GRCm39) missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 26,736,046 (GRCm39) missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 26,733,563 (GRCm39) missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 26,731,967 (GRCm39) missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 26,731,967 (GRCm39) missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2119:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2120:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2121:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2122:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2124:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2144:Cyp2a12 UTSW 7 26,734,194 (GRCm39) missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 26,732,042 (GRCm39) missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 26,729,057 (GRCm39) missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 26,730,571 (GRCm39) missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 26,734,057 (GRCm39) missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 26,728,700 (GRCm39) missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 26,730,640 (GRCm39) nonsense probably null
R4960:Cyp2a12 UTSW 7 26,733,575 (GRCm39) missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 26,736,046 (GRCm39) missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 26,736,036 (GRCm39) missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 26,735,888 (GRCm39) critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 26,730,643 (GRCm39) missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 26,728,550 (GRCm39) missense unknown
R5524:Cyp2a12 UTSW 7 26,730,656 (GRCm39) missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 26,728,504 (GRCm39) splice site probably null
R6320:Cyp2a12 UTSW 7 26,730,577 (GRCm39) missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 26,733,581 (GRCm39) missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 26,728,677 (GRCm39) missense probably benign 0.13
R8191:Cyp2a12 UTSW 7 26,730,529 (GRCm39) missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 26,732,083 (GRCm39) nonsense probably null
R9083:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9084:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 26,734,785 (GRCm39) missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 26,734,845 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCTCTTCAGGGAAGCGATTCTG -3'
(R):5'- GTGACAGCTGTTGTTACTGC -3'

Sequencing Primer
(F):5'- ATTCTGCTTGGGAGACAGCC -3'
(R):5'- ACTGCTGCTCACTGTGTG -3'
Posted On 2020-06-30