Incidental Mutation 'R8093:Cyp2a12'
ID 629997
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 27029081-27037375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27036629 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 488 (S488G)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably damaging
Transcript: ENSMUST00000075552
AA Change: S488G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: S488G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Ddx55 C A 5: 124,556,820 H104N possibly damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Map2k6 A C 11: 110,482,585 E21D probably benign Het
Mcoln1 T A 8: 3,508,740 I246N possibly damaging Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Slc12a2 A G 18: 57,879,351 H182R probably benign Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 27036611 missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 27032583 missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 27031158 missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 27032542 missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 27031206 missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 27029592 missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 27036621 missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 27034138 missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 27036646 makesense probably null
R2119:Cyp2a12 UTSW 7 27036646 makesense probably null
R2120:Cyp2a12 UTSW 7 27036646 makesense probably null
R2121:Cyp2a12 UTSW 7 27036646 makesense probably null
R2122:Cyp2a12 UTSW 7 27036646 makesense probably null
R2124:Cyp2a12 UTSW 7 27036646 makesense probably null
R2144:Cyp2a12 UTSW 7 27034769 missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 27032617 missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 27029632 missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 27031146 missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 27034632 missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 27029275 missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 27031215 nonsense probably null
R4960:Cyp2a12 UTSW 7 27034150 missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 27036621 missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 27036611 missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 27036463 critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 27031218 missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 27029125 missense unknown
R5524:Cyp2a12 UTSW 7 27031231 missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 27029079 splice site probably null
R6320:Cyp2a12 UTSW 7 27031152 missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 27034156 missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 27029252 missense probably benign 0.13
R8191:Cyp2a12 UTSW 7 27031104 missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 27032658 nonsense probably null
R9083:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9084:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 27035360 missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 27035420 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCTCTTCAGGGAAGCGATTCTG -3'
(R):5'- GTGACAGCTGTTGTTACTGC -3'

Sequencing Primer
(F):5'- ATTCTGCTTGGGAGACAGCC -3'
(R):5'- ACTGCTGCTCACTGTGTG -3'
Posted On 2020-06-30