Incidental Mutation 'R8093:Numbl'
ID 629998
Institutional Source Beutler Lab
Gene Symbol Numbl
Ensembl Gene ENSMUSG00000063160
Gene Name numb-like
Synonyms nbl
MMRRC Submission 067525-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26957884-26981570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26980461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 481 (M481K)
Ref Sequence ENSEMBL: ENSMUSP00000078245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079258]
AlphaFold O08919
Predicted Effect possibly damaging
Transcript: ENSMUST00000079258
AA Change: M481K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078245
Gene: ENSMUSG00000063160
AA Change: M481K

DomainStartEndE-ValueType
PTB 75 205 1.11e-38 SMART
low complexity region 234 260 N/A INTRINSIC
Pfam:NumbF 287 371 3.5e-32 PFAM
coiled coil region 417 444 N/A INTRINSIC
low complexity region 532 574 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypes except for a reduction in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,669,368 (GRCm39) T745S possibly damaging Het
Abca12 T C 1: 71,319,552 (GRCm39) I1777V probably benign Het
Abhd6 T C 14: 8,028,353 (GRCm38) L28P probably damaging Het
Angpt1 T A 15: 42,339,873 (GRCm39) E279D probably benign Het
Arfgef2 A G 2: 166,736,577 (GRCm39) M1750V probably benign Het
Atrn T C 2: 130,817,908 (GRCm39) F821L probably benign Het
Cbx3 A G 6: 51,458,748 (GRCm39) E71G possibly damaging Het
Ccdc14 G A 16: 34,530,022 (GRCm39) A482T probably damaging Het
Cdh15 G T 8: 123,593,574 (GRCm39) A723S probably damaging Het
Cyp2a12 A G 7: 26,736,054 (GRCm39) S488G probably damaging Het
Ddx55 C A 5: 124,694,883 (GRCm39) H104N possibly damaging Het
Det1 G T 7: 78,493,257 (GRCm39) T249N possibly damaging Het
Disp3 A G 4: 148,354,973 (GRCm39) S348P possibly damaging Het
Dnah6 T G 6: 73,137,896 (GRCm39) N936T probably damaging Het
Dnajc11 A T 4: 152,054,357 (GRCm39) N188Y probably damaging Het
Etaa1 G A 11: 17,897,559 (GRCm39) T186I possibly damaging Het
Fhip1a T C 3: 85,580,111 (GRCm39) D698G probably benign Het
Ftl1-ps1 T A 13: 74,555,138 (GRCm39) V139E probably benign Het
Fzd10 A G 5: 128,679,303 (GRCm39) K341R probably benign Het
Galnt7 A G 8: 57,985,739 (GRCm39) Y544H probably benign Het
Gm21190 T A 5: 15,730,814 (GRCm39) I181F possibly damaging Het
Gm3604 T C 13: 62,517,363 (GRCm39) N332D probably damaging Het
Gm47996 G T 1: 151,086,055 (GRCm39) E45D possibly damaging Het
Gm5475 T A 15: 100,321,893 (GRCm39) L14Q unknown Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr182 T C 10: 127,586,783 (GRCm39) Y56C probably damaging Het
Gxylt2 T A 6: 100,710,188 (GRCm39) W110R probably damaging Het
Hivep3 G T 4: 119,952,632 (GRCm39) R316L possibly damaging Het
Hnf1a T C 5: 115,093,336 (GRCm39) T310A probably benign Het
Igkv6-32 A G 6: 70,051,547 (GRCm39) F8L probably benign Het
Kcnq1 A G 7: 142,916,389 (GRCm39) N550D probably damaging Het
Lrrc40 T G 3: 157,757,419 (GRCm39) Y249* probably null Het
Lrrc43 T A 5: 123,639,192 (GRCm39) M407K probably benign Het
Map2k6 A C 11: 110,373,411 (GRCm39) E21D probably benign Het
Mcoln1 T A 8: 3,558,740 (GRCm39) I246N possibly damaging Het
Msantd5f6 A T 4: 73,321,759 (GRCm39) V92E probably damaging Het
Myh2 A G 11: 67,079,536 (GRCm39) K998E probably damaging Het
Myo1b C T 1: 51,797,034 (GRCm39) probably null Het
Nxpe4 G T 9: 48,307,852 (GRCm39) V319F probably benign Het
Pam C A 1: 97,813,357 (GRCm39) D358Y probably damaging Het
Papola A G 12: 105,775,836 (GRCm39) M251V probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Prelid2 A G 18: 42,065,700 (GRCm39) S112P probably damaging Het
Ptgfrn T C 3: 100,963,753 (GRCm39) T620A probably benign Het
Ptgfrn C T 3: 100,980,257 (GRCm39) R361Q probably benign Het
Pygm T A 19: 6,436,072 (GRCm39) M148K probably damaging Het
Ren1 T A 1: 133,287,812 (GRCm39) I382N probably damaging Het
Rev1 T C 1: 38,114,097 (GRCm39) probably benign Het
Sdsl T C 5: 120,598,017 (GRCm39) K159E probably benign Het
Serinc4 T C 2: 121,285,434 (GRCm39) N203S possibly damaging Het
Slc12a2 A G 18: 58,012,423 (GRCm39) H182R probably benign Het
Sned1 C A 1: 93,202,387 (GRCm39) T677K possibly damaging Het
Ston2 G A 12: 91,710,460 (GRCm39) T3I probably damaging Het
Tnf T C 17: 35,420,072 (GRCm39) T77A probably benign Het
Trav6-2 G A 14: 52,905,126 (GRCm39) G49E probably benign Het
Trav7-4 A T 14: 53,699,140 (GRCm39) I96F probably damaging Het
Trmu T A 15: 85,766,921 (GRCm39) D43E probably benign Het
Uggt1 T A 1: 36,266,566 (GRCm39) Q136L probably damaging Het
Ugt1a5 T A 1: 88,094,304 (GRCm39) Y177* probably null Het
Vmn1r126 T C 7: 21,034,516 (GRCm39) R293G probably damaging Het
Vmn2r89 A G 14: 51,693,699 (GRCm39) I350V probably benign Het
Vps11 A T 9: 44,267,529 (GRCm39) L361Q probably damaging Het
Zfp467 A G 6: 48,420,366 (GRCm39) L5P possibly damaging Het
Zfp652 A G 11: 95,640,288 (GRCm39) H71R probably damaging Het
Zfp804b T C 5: 6,820,082 (GRCm39) K994E probably benign Het
Other mutations in Numbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Numbl APN 7 26,968,235 (GRCm39) missense possibly damaging 0.50
IGL01389:Numbl APN 7 26,980,472 (GRCm39) missense possibly damaging 0.94
IGL02671:Numbl APN 7 26,964,327 (GRCm39) missense probably damaging 1.00
F5770:Numbl UTSW 7 26,979,027 (GRCm39) missense probably benign
R0212:Numbl UTSW 7 26,980,184 (GRCm39) missense probably damaging 1.00
R0709:Numbl UTSW 7 26,973,415 (GRCm39) missense probably damaging 1.00
R1768:Numbl UTSW 7 26,980,379 (GRCm39) missense probably benign
R2181:Numbl UTSW 7 26,968,346 (GRCm39) critical splice donor site probably null
R5071:Numbl UTSW 7 26,980,415 (GRCm39) missense probably damaging 1.00
R5072:Numbl UTSW 7 26,980,415 (GRCm39) missense probably damaging 1.00
R5074:Numbl UTSW 7 26,980,415 (GRCm39) missense probably damaging 1.00
R6134:Numbl UTSW 7 26,980,739 (GRCm39) missense probably damaging 0.98
R6387:Numbl UTSW 7 26,976,115 (GRCm39) missense probably damaging 0.99
R6989:Numbl UTSW 7 26,980,265 (GRCm39) missense probably damaging 1.00
R7510:Numbl UTSW 7 26,971,412 (GRCm39) splice site probably null
R8518:Numbl UTSW 7 26,964,361 (GRCm39) missense probably benign 0.12
R9449:Numbl UTSW 7 26,976,327 (GRCm39) missense
V7580:Numbl UTSW 7 26,979,027 (GRCm39) missense probably benign
V7583:Numbl UTSW 7 26,979,027 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGTTGGAGGAAGTGTCCC -3'
(R):5'- TTTCTCCACAGCGGGTTTG -3'

Sequencing Primer
(F):5'- AGTGTCCCAGGTGGCTAAG -3'
(R):5'- CACAGCGGGTTTGCCTTCTAG -3'
Posted On 2020-06-30