Incidental Mutation 'R8093:Mcoln1'
ID 630001
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Name mucolipin 1
Synonyms TRPML1, mucolipidin, 2210015I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3500457-3515232 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3508740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 246 (I246N)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306] [ENSMUST00000208359]
AlphaFold Q99J21
Predicted Effect possibly damaging
Transcript: ENSMUST00000004683
AA Change: I246N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: I246N

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161842
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Cyp2a12 A G 7: 27,036,629 S488G probably damaging Het
Ddx55 C A 5: 124,556,820 H104N possibly damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Map2k6 A C 11: 110,482,585 E21D probably benign Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Slc12a2 A G 18: 57,879,351 H182R probably benign Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7936:Mcoln1 UTSW 8 3505924 missense probably damaging 1.00
R8058:Mcoln1 UTSW 8 3508378 missense probably benign
R8082:Mcoln1 UTSW 8 3507420 missense probably benign 0.01
R9090:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
R9271:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCAGTGACCTATCAGG -3'
(R):5'- ATGACAGCTGGTCCATGTC -3'

Sequencing Primer
(F):5'- CTATCAGGTCGCTGAGTGAGC -3'
(R):5'- ACAGCTGGTCCATGTCCTAGC -3'
Posted On 2020-06-30