Incidental Mutation 'R8093:Galnt7'
ID 630002
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Name polypeptide N-acetylgalactosaminyltransferase 7
Synonyms ppGaNTase-T7
MMRRC Submission 067525-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.830) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 57976862-58106066 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57985739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 544 (Y544H)
Ref Sequence ENSEMBL: ENSMUSP00000034021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
AlphaFold Q80VA0
Predicted Effect probably benign
Transcript: ENSMUST00000034021
AA Change: Y544H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: Y544H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110316
AA Change: Y544H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: Y544H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,669,368 (GRCm39) T745S possibly damaging Het
Abca12 T C 1: 71,319,552 (GRCm39) I1777V probably benign Het
Abhd6 T C 14: 8,028,353 (GRCm38) L28P probably damaging Het
Angpt1 T A 15: 42,339,873 (GRCm39) E279D probably benign Het
Arfgef2 A G 2: 166,736,577 (GRCm39) M1750V probably benign Het
Atrn T C 2: 130,817,908 (GRCm39) F821L probably benign Het
Cbx3 A G 6: 51,458,748 (GRCm39) E71G possibly damaging Het
Ccdc14 G A 16: 34,530,022 (GRCm39) A482T probably damaging Het
Cdh15 G T 8: 123,593,574 (GRCm39) A723S probably damaging Het
Cyp2a12 A G 7: 26,736,054 (GRCm39) S488G probably damaging Het
Ddx55 C A 5: 124,694,883 (GRCm39) H104N possibly damaging Het
Det1 G T 7: 78,493,257 (GRCm39) T249N possibly damaging Het
Disp3 A G 4: 148,354,973 (GRCm39) S348P possibly damaging Het
Dnah6 T G 6: 73,137,896 (GRCm39) N936T probably damaging Het
Dnajc11 A T 4: 152,054,357 (GRCm39) N188Y probably damaging Het
Etaa1 G A 11: 17,897,559 (GRCm39) T186I possibly damaging Het
Fhip1a T C 3: 85,580,111 (GRCm39) D698G probably benign Het
Ftl1-ps1 T A 13: 74,555,138 (GRCm39) V139E probably benign Het
Fzd10 A G 5: 128,679,303 (GRCm39) K341R probably benign Het
Gm21190 T A 5: 15,730,814 (GRCm39) I181F possibly damaging Het
Gm3604 T C 13: 62,517,363 (GRCm39) N332D probably damaging Het
Gm47996 G T 1: 151,086,055 (GRCm39) E45D possibly damaging Het
Gm5475 T A 15: 100,321,893 (GRCm39) L14Q unknown Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr182 T C 10: 127,586,783 (GRCm39) Y56C probably damaging Het
Gxylt2 T A 6: 100,710,188 (GRCm39) W110R probably damaging Het
Hivep3 G T 4: 119,952,632 (GRCm39) R316L possibly damaging Het
Hnf1a T C 5: 115,093,336 (GRCm39) T310A probably benign Het
Igkv6-32 A G 6: 70,051,547 (GRCm39) F8L probably benign Het
Kcnq1 A G 7: 142,916,389 (GRCm39) N550D probably damaging Het
Lrrc40 T G 3: 157,757,419 (GRCm39) Y249* probably null Het
Lrrc43 T A 5: 123,639,192 (GRCm39) M407K probably benign Het
Map2k6 A C 11: 110,373,411 (GRCm39) E21D probably benign Het
Mcoln1 T A 8: 3,558,740 (GRCm39) I246N possibly damaging Het
Msantd5f6 A T 4: 73,321,759 (GRCm39) V92E probably damaging Het
Myh2 A G 11: 67,079,536 (GRCm39) K998E probably damaging Het
Myo1b C T 1: 51,797,034 (GRCm39) probably null Het
Numbl T A 7: 26,980,461 (GRCm39) M481K possibly damaging Het
Nxpe4 G T 9: 48,307,852 (GRCm39) V319F probably benign Het
Pam C A 1: 97,813,357 (GRCm39) D358Y probably damaging Het
Papola A G 12: 105,775,836 (GRCm39) M251V probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Prelid2 A G 18: 42,065,700 (GRCm39) S112P probably damaging Het
Ptgfrn T C 3: 100,963,753 (GRCm39) T620A probably benign Het
Ptgfrn C T 3: 100,980,257 (GRCm39) R361Q probably benign Het
Pygm T A 19: 6,436,072 (GRCm39) M148K probably damaging Het
Ren1 T A 1: 133,287,812 (GRCm39) I382N probably damaging Het
Rev1 T C 1: 38,114,097 (GRCm39) probably benign Het
Sdsl T C 5: 120,598,017 (GRCm39) K159E probably benign Het
Serinc4 T C 2: 121,285,434 (GRCm39) N203S possibly damaging Het
Slc12a2 A G 18: 58,012,423 (GRCm39) H182R probably benign Het
Sned1 C A 1: 93,202,387 (GRCm39) T677K possibly damaging Het
Ston2 G A 12: 91,710,460 (GRCm39) T3I probably damaging Het
Tnf T C 17: 35,420,072 (GRCm39) T77A probably benign Het
Trav6-2 G A 14: 52,905,126 (GRCm39) G49E probably benign Het
Trav7-4 A T 14: 53,699,140 (GRCm39) I96F probably damaging Het
Trmu T A 15: 85,766,921 (GRCm39) D43E probably benign Het
Uggt1 T A 1: 36,266,566 (GRCm39) Q136L probably damaging Het
Ugt1a5 T A 1: 88,094,304 (GRCm39) Y177* probably null Het
Vmn1r126 T C 7: 21,034,516 (GRCm39) R293G probably damaging Het
Vmn2r89 A G 14: 51,693,699 (GRCm39) I350V probably benign Het
Vps11 A T 9: 44,267,529 (GRCm39) L361Q probably damaging Het
Zfp467 A G 6: 48,420,366 (GRCm39) L5P possibly damaging Het
Zfp652 A G 11: 95,640,288 (GRCm39) H71R probably damaging Het
Zfp804b T C 5: 6,820,082 (GRCm39) K994E probably benign Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57,993,073 (GRCm39) missense probably damaging 1.00
IGL00538:Galnt7 APN 8 58,005,556 (GRCm39) missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57,993,105 (GRCm39) nonsense probably null
IGL00951:Galnt7 APN 8 58,036,858 (GRCm39) missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57,984,769 (GRCm39) splice site probably benign
IGL02280:Galnt7 APN 8 57,989,824 (GRCm39) missense probably damaging 1.00
IGL02832:Galnt7 APN 8 58,005,531 (GRCm39) missense probably damaging 1.00
IGL02936:Galnt7 APN 8 58,037,248 (GRCm39) missense probably benign
IGL03083:Galnt7 APN 8 57,979,223 (GRCm39) missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57,979,212 (GRCm39) missense probably benign 0.01
R0400:Galnt7 UTSW 8 58,037,023 (GRCm39) missense probably damaging 0.99
R0553:Galnt7 UTSW 8 58,005,464 (GRCm39) splice site probably benign
R1463:Galnt7 UTSW 8 58,105,892 (GRCm39) missense probably benign
R1487:Galnt7 UTSW 8 57,993,073 (GRCm39) missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57,995,564 (GRCm39) missense probably benign 0.05
R1817:Galnt7 UTSW 8 57,991,212 (GRCm39) missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57,985,748 (GRCm39) missense probably benign 0.13
R3855:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R3856:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R4232:Galnt7 UTSW 8 58,106,000 (GRCm39) missense probably benign
R4396:Galnt7 UTSW 8 57,991,215 (GRCm39) missense probably damaging 1.00
R4426:Galnt7 UTSW 8 58,005,606 (GRCm39) nonsense probably null
R4610:Galnt7 UTSW 8 57,998,803 (GRCm39) missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57,995,761 (GRCm39) intron probably benign
R4794:Galnt7 UTSW 8 57,998,397 (GRCm39) missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57,998,414 (GRCm39) missense probably damaging 1.00
R5177:Galnt7 UTSW 8 58,037,061 (GRCm39) missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 58,036,967 (GRCm39) nonsense probably null
R6122:Galnt7 UTSW 8 57,979,200 (GRCm39) missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57,989,612 (GRCm39) splice site probably null
R6684:Galnt7 UTSW 8 57,991,143 (GRCm39) missense probably benign 0.16
R6752:Galnt7 UTSW 8 58,105,985 (GRCm39) missense probably damaging 1.00
R7464:Galnt7 UTSW 8 58,037,054 (GRCm39) missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 58,005,552 (GRCm39) missense probably damaging 0.97
R7547:Galnt7 UTSW 8 58,036,996 (GRCm39) missense possibly damaging 0.48
R8221:Galnt7 UTSW 8 58,005,600 (GRCm39) missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57,991,222 (GRCm39) missense probably benign 0.34
R8402:Galnt7 UTSW 8 57,995,953 (GRCm39) missense probably damaging 0.98
R8779:Galnt7 UTSW 8 58,037,245 (GRCm39) missense probably benign
R8894:Galnt7 UTSW 8 57,979,176 (GRCm39) nonsense probably null
R8974:Galnt7 UTSW 8 58,105,934 (GRCm39) missense
R9106:Galnt7 UTSW 8 57,985,729 (GRCm39) missense probably damaging 1.00
R9297:Galnt7 UTSW 8 57,995,555 (GRCm39) missense probably damaging 0.98
X0050:Galnt7 UTSW 8 58,005,478 (GRCm39) frame shift probably null
X0062:Galnt7 UTSW 8 58,036,942 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTGCAGACATTTCTACATTTCCC -3'
(R):5'- CCTCTCAGTCACATGGATGC -3'

Sequencing Primer
(F):5'- TCTATAAGGAAGTCTTGGCACCC -3'
(R):5'- TCTCAGTCACATGGATGCTAAAACAG -3'
Posted On 2020-06-30