Incidental Mutation 'R8093:Map2k6'
ID 630010
Institutional Source Beutler Lab
Gene Symbol Map2k6
Ensembl Gene ENSMUSG00000020623
Gene Name mitogen-activated protein kinase kinase 6
Synonyms MAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8093 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 110399122-110525522 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 110482585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 21 (E21D)
Ref Sequence ENSEMBL: ENSMUSP00000020949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]
AlphaFold P70236
Predicted Effect probably benign
Transcript: ENSMUST00000020949
AA Change: E21D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: E21D

DomainStartEndE-ValueType
S_TKc 53 314 2.82e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100260
AA Change: E21D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: E21D

DomainStartEndE-ValueType
Pfam:Pkinase 53 288 4.3e-47 PFAM
Pfam:Pkinase_Tyr 53 289 1.2e-32 PFAM
Pfam:Kinase-like 57 274 7.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Cyp2a12 A G 7: 27,036,629 S488G probably damaging Het
Ddx55 C A 5: 124,556,820 H104N possibly damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Mcoln1 T A 8: 3,508,740 I246N possibly damaging Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Slc12a2 A G 18: 57,879,351 H182R probably benign Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Map2k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Map2k6 APN 11 110496411 missense probably damaging 1.00
IGL01778:Map2k6 APN 11 110512869 intron probably benign
IGL02058:Map2k6 APN 11 110492583 missense probably damaging 1.00
IGL02580:Map2k6 APN 11 110490841 missense probably damaging 0.98
IGL03139:Map2k6 APN 11 110496473 splice site probably benign
Heartening UTSW 11 110492908 missense
Uplifting UTSW 11 110492562 missense probably damaging 1.00
R0230:Map2k6 UTSW 11 110496455 missense probably damaging 1.00
R0361:Map2k6 UTSW 11 110499509 missense probably damaging 0.99
R0634:Map2k6 UTSW 11 110494343 nonsense probably null
R1716:Map2k6 UTSW 11 110497901 missense probably damaging 1.00
R2214:Map2k6 UTSW 11 110496341 missense probably damaging 1.00
R2279:Map2k6 UTSW 11 110499464 missense probably damaging 1.00
R4610:Map2k6 UTSW 11 110499474 missense probably damaging 1.00
R4677:Map2k6 UTSW 11 110399394 utr 5 prime probably benign
R5299:Map2k6 UTSW 11 110492963 missense probably benign 0.03
R5761:Map2k6 UTSW 11 110399371 utr 5 prime probably benign
R5996:Map2k6 UTSW 11 110497906 missense possibly damaging 0.77
R6391:Map2k6 UTSW 11 110490877 critical splice donor site probably null
R6529:Map2k6 UTSW 11 110492562 missense probably damaging 1.00
R7020:Map2k6 UTSW 11 110506714 intron probably benign
R7345:Map2k6 UTSW 11 110492908 missense
R7681:Map2k6 UTSW 11 110497903 nonsense probably null
R7980:Map2k6 UTSW 11 110499384 missense
R8087:Map2k6 UTSW 11 110490176 missense probably benign 0.00
R8531:Map2k6 UTSW 11 110399349 start gained probably benign
R8834:Map2k6 UTSW 11 110492593 nonsense probably null
R9028:Map2k6 UTSW 11 110497973 missense
Predicted Primers PCR Primer
(F):5'- CCCCAAATTGCCTCTGAGAAG -3'
(R):5'- AACGTGAGCAAAGAACTTTCCTC -3'

Sequencing Primer
(F):5'- CCAAATTGCCTCTGAGAAGCTGTG -3'
(R):5'- TCCTCTCAAAGGGCTGAATG -3'
Posted On 2020-06-30