Incidental Mutation 'R8093:Slc12a2'
ID630028
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8093 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57879351 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 182 (H182R)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably benign
Transcript: ENSMUST00000115366
AA Change: H182R

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: H182R

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,851,504 T745S possibly damaging Het
Abca12 T C 1: 71,280,393 I1777V probably benign Het
Abhd6 T C 14: 8,028,353 L28P probably damaging Het
Angpt1 T A 15: 42,476,477 E279D probably benign Het
Arfgef2 A G 2: 166,894,657 M1750V probably benign Het
Atrn T C 2: 130,975,988 F821L probably benign Het
Cbx3 A G 6: 51,481,768 E71G possibly damaging Het
Ccdc14 G A 16: 34,709,652 A482T probably damaging Het
Cdh15 G T 8: 122,866,835 A723S probably damaging Het
Cyp2a12 A G 7: 27,036,629 S488G probably damaging Het
Ddx55 C A 5: 124,556,820 H104N possibly damaging Het
Det1 G T 7: 78,843,509 T249N possibly damaging Het
Disp3 A G 4: 148,270,516 S348P possibly damaging Het
Dnah6 T G 6: 73,160,913 N936T probably damaging Het
Dnajc11 A T 4: 151,969,900 N188Y probably damaging Het
Etaa1 G A 11: 17,947,559 T186I possibly damaging Het
Fam160a1 T C 3: 85,672,804 D698G probably benign Het
Ftl1-ps1 T A 13: 74,407,019 V139E probably benign Het
Fzd10 A G 5: 128,602,239 K341R probably benign Het
Galnt7 A G 8: 57,532,705 Y544H probably benign Het
Gm11487 A T 4: 73,403,522 V92E probably damaging Het
Gm21190 T A 5: 15,525,816 I181F possibly damaging Het
Gm3604 T C 13: 62,369,549 N332D probably damaging Het
Gm47996 G T 1: 151,210,304 E45D possibly damaging Het
Gm5475 T A 15: 100,424,012 L14Q unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr182 T C 10: 127,750,914 Y56C probably damaging Het
Gxylt2 T A 6: 100,733,227 W110R probably damaging Het
Hivep3 G T 4: 120,095,435 R316L possibly damaging Het
Hnf1a T C 5: 114,955,277 T310A probably benign Het
Igkv6-32 A G 6: 70,074,563 F8L probably benign Het
Kcnq1 A G 7: 143,362,652 N550D probably damaging Het
Lrrc40 T G 3: 158,051,782 Y249* probably null Het
Lrrc43 T A 5: 123,501,129 M407K probably benign Het
Map2k6 A C 11: 110,482,585 E21D probably benign Het
Mcoln1 T A 8: 3,508,740 I246N possibly damaging Het
Myh2 A G 11: 67,188,710 K998E probably damaging Het
Myo1b C T 1: 51,757,875 probably null Het
Numbl T A 7: 27,281,036 M481K possibly damaging Het
Nxpe4 G T 9: 48,396,552 V319F probably benign Het
Pam C A 1: 97,885,632 D358Y probably damaging Het
Papola A G 12: 105,809,577 M251V probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Prelid2 A G 18: 41,932,635 S112P probably damaging Het
Ptgfrn T C 3: 101,056,437 T620A probably benign Het
Ptgfrn C T 3: 101,072,941 R361Q probably benign Het
Pygm T A 19: 6,386,042 M148K probably damaging Het
Ren1 T A 1: 133,360,074 I382N probably damaging Het
Rev1 T C 1: 38,075,016 probably benign Het
Sdsl T C 5: 120,459,952 K159E probably benign Het
Serinc4 T C 2: 121,454,953 N203S possibly damaging Het
Sned1 C A 1: 93,274,665 T677K possibly damaging Het
Ston2 G A 12: 91,743,686 T3I probably damaging Het
Tnf T C 17: 35,201,096 T77A probably benign Het
Trav6-2 G A 14: 52,667,669 G49E probably benign Het
Trav7-4 A T 14: 53,461,683 I96F probably damaging Het
Trmu T A 15: 85,882,720 D43E probably benign Het
Uggt1 T A 1: 36,227,485 Q136L probably damaging Het
Ugt1a5 T A 1: 88,166,582 Y177* probably null Het
Vmn1r126 T C 7: 21,300,591 R293G probably damaging Het
Vmn2r89 A G 14: 51,456,242 I350V probably benign Het
Vps11 A T 9: 44,356,232 L361Q probably damaging Het
Zfp467 A G 6: 48,443,432 L5P possibly damaging Het
Zfp652 A G 11: 95,749,462 H71R probably damaging Het
Zfp804b T C 5: 6,770,082 K994E probably benign Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 splice site probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
R7411:Slc12a2 UTSW 18 57941013 missense probably benign 0.01
R7508:Slc12a2 UTSW 18 57904393 missense probably benign 0.01
R7645:Slc12a2 UTSW 18 57896378 missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 57932524 missense probably benign 0.02
R8054:Slc12a2 UTSW 18 57921872 nonsense probably null
R8099:Slc12a2 UTSW 18 57899392 missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 57899331 missense probably benign 0.44
R8214:Slc12a2 UTSW 18 57937719 missense probably benign 0.29
R8273:Slc12a2 UTSW 18 57914266 splice site probably benign
R8341:Slc12a2 UTSW 18 57879209 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAAGAGGATGCTACTACGGC -3'
(R):5'- TTTTCCAGCTCATCGTGGAG -3'

Sequencing Primer
(F):5'- ATGCTACTACGGCTGGGAG -3'
(R):5'- TCATCGTGGAGCTCTGCCAG -3'
Posted On2020-06-30