Incidental Mutation 'R8094:Rb1cc1'
ID630030
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene NameRB1-inducible coiled-coil 1
SynonymsCc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location6206197-6276648 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 6263224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1429 (R1429*)
Ref Sequence ENSEMBL: ENSMUSP00000027040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000159530]
Predicted Effect probably null
Transcript: ENSMUST00000027040
AA Change: R1429*
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: R1429*

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159530
AA Change: R71*
SMART Domains Protein: ENSMUSP00000124220
Gene: ENSMUSG00000025907
AA Change: R71*

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:ATG11 84 223 1.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161327
AA Change: R1308*
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: R1308*

DomainStartEndE-ValueType
low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162257
AA Change: R519*
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907
AA Change: R519*

DomainStartEndE-ValueType
coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
fingerling UTSW 1 6261032 missense probably damaging 1.00
tots UTSW 1 6245637 missense probably damaging 0.99
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 splice site probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3967:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3969:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6054:Rb1cc1 UTSW 1 6249834 missense probably benign 0.01
R6064:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
R7031:Rb1cc1 UTSW 1 6238466 critical splice donor site probably null
R7066:Rb1cc1 UTSW 1 6250005 missense possibly damaging 0.69
R7185:Rb1cc1 UTSW 1 6238383 missense probably damaging 1.00
R7276:Rb1cc1 UTSW 1 6249192 missense probably benign 0.13
R7448:Rb1cc1 UTSW 1 6245503 missense probably damaging 1.00
R7463:Rb1cc1 UTSW 1 6249180 missense probably benign
R7484:Rb1cc1 UTSW 1 6274217 missense probably damaging 1.00
R7496:Rb1cc1 UTSW 1 6248191 missense probably null 0.02
R7618:Rb1cc1 UTSW 1 6265558 splice site probably null
R7681:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R7774:Rb1cc1 UTSW 1 6248085 missense possibly damaging 0.63
R7780:Rb1cc1 UTSW 1 6248914 nonsense probably null
R7947:Rb1cc1 UTSW 1 6248562 missense probably damaging 1.00
R8057:Rb1cc1 UTSW 1 6245219 missense probably damaging 1.00
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTTTGCTTGAAGAGAAGAAGC -3'
(R):5'- GAGGTCACTTTCCACTCTGG -3'

Sequencing Primer
(F):5'- TGCTTGAAGAGAAGAAGCAGCTTG -3'
(R):5'- GCCTCAGCTAAATTGCTTTGAG -3'
Posted On2020-06-30