Mutagenetix > Incidental Mutation

Incidental Mutation 'R8094:Cacna1e'

630038

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

Accession Numbers

Genbank: NM_009782; MGI: 106217

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R8094 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 154561770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 340 (S340F)

Ref Sequence

ENSEMBL: ENSMUSP00000140937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004214
AA Change: S32F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: S32F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187541
AA Change: S340F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: S340F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211821
AA Change: S278F

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	T	A	8: 12,279,824	L93H	unknown	Het
A2ml1	A	G	6: 128,572,082	Y246H	probably damaging	Het
Akap11	C	A	14: 78,512,973	C658F		Het
Akap2	A	G	4: 57,886,319	T859A	possibly damaging	Het
Arid2	T	G	15: 96,368,711	S547A	possibly damaging	Het
Atf1	C	A	15: 100,245,289	D46E	probably damaging	Het
Brca2	T	A	5: 150,536,169	F303Y	possibly damaging	Het
Btbd18	T	A	2: 84,667,916	S633T	possibly damaging	Het
Btg4	T	G	9: 51,119,145	F182V	probably benign	Het
Camta2	A	G	11: 70,686,077	W41R	probably damaging	Het
Cbl	A	T	9: 44,163,399	D455E	probably benign	Het
Ccdc162	A	T	10: 41,612,868	D1208E	probably benign	Het
Cd177	A	T	7: 24,744,417	M752K	probably damaging	Het
Cep290	A	T	10: 100,544,931	H100L	possibly damaging	Het
Chrnb2	T	A	3: 89,761,391	I206F	probably damaging	Het
Cyp2c40	A	G	19: 39,802,565	L274S	probably benign	Het
Cyp2c40	T	A	19: 39,802,571	Y272F	probably benign	Het
Cyp2d22	C	A	15: 82,374,355	A102S	probably benign	Het
Cyp51	C	T	5: 4,086,490	E435K	probably benign	Het
Dchs2	T	C	3: 83,355,622	F3066L	probably benign	Het
Disp1	C	A	1: 183,087,628	R1076L	probably damaging	Het
Dkk2	C	T	3: 132,086,040	A3V	probably benign	Het
Dnah7b	T	C	1: 46,126,804	F543S	probably benign	Het
Dpt	A	T	1: 164,796,912	S61C	probably damaging	Het
Drg2	A	T	11: 60,462,270	Y243F	probably damaging	Het
Dsg2	A	G	18: 20,583,004		probably benign	Het
Dst	T	G	1: 34,188,959	L1878V	possibly damaging	Het
F5	A	G	1: 164,208,940	Y1890C	probably benign	Het
Fat1	T	C	8: 44,952,702	V830A	probably damaging	Het
Fat2	C	T	11: 55,296,139	D1294N	probably benign	Het
Fbxo15	A	G	18: 84,965,493	Y322C	probably benign	Het
Fhit	A	T	14: 10,751,666	N7K	unknown	Het
Fuk	A	G	8: 110,895,972	F108S	probably damaging	Het
Gabrb2	A	G	11: 42,597,543	I279V	probably damaging	Het
Galk2	T	C	2: 125,931,269	F207S	probably damaging	Het
Gm16486	T	C	8: 70,709,418	V420A	probably benign	Het
Gtpbp3	C	T	8: 71,488,836	L17F	possibly damaging	Het
Gucy2c	T	A	6: 136,737,448	D460V	probably benign	Het
Herc1	G	A	9: 66,493,180	V4329I	probably damaging	Het
Kirrel3	G	A	9: 35,035,164	V740M	probably damaging	Het
Macf1	C	A	4: 123,369,867	V6956L	probably damaging	Het
Mill1	C	T	7: 18,255,910	A39V	probably benign	Het
Mkln1	T	A	6: 31,492,653	Y599*	probably null	Het
Mrpl14	T	A	17: 45,698,113	L46Q	possibly damaging	Het
Myom2	G	T	8: 15,069,418	R103L	possibly damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ndst2	A	T	14: 20,728,164	V449D	probably damaging	Het
Nell1	T	A	7: 50,120,587	H131Q	probably benign	Het
Nos3	G	C	5: 24,367,220	R97P	probably benign	Het
Npc1	A	T	18: 12,194,240	F1099L	probably benign	Het
Nxpe5	T	A	5: 138,251,540	W531R	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1215	T	C	2: 89,002,368		probably benign	Het
Olfr1450	A	T	19: 12,954,002	T138S	probably benign	Het
Olfr3	A	T	2: 36,812,318	L258H	probably damaging	Het
Olfr800	A	G	10: 129,660,064	D86G	probably damaging	Het
Osmr	T	C	15: 6,815,621	N889S	possibly damaging	Het
Oxct2b	A	G	4: 123,116,508	I74V	possibly damaging	Het
Phldb3	C	A	7: 24,626,709	A572D	probably damaging	Het
Pigr	A	G	1: 130,846,510	E409G	probably damaging	Het
Ptprs	T	C	17: 56,428,947	E674G	probably benign	Het
Ptpru	G	A	4: 131,793,592	T801I	possibly damaging	Het
Ralgapa1	T	A	12: 55,782,846	D200V	probably damaging	Het
Rb1cc1	A	T	1: 6,263,224	R1429*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnpep	A	T	1: 135,283,776	L78Q	probably damaging	Het
Rtn2	A	T	7: 19,293,866	I394F	probably damaging	Het
Satb2	A	T	1: 56,831,464	V572D	possibly damaging	Het
Sds	T	C	5: 120,478,936		probably benign	Het
Serpina10	TTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCC	12: 103,628,773		probably benign	Het
Sgo2a	T	C	1: 58,017,141	I828T	possibly damaging	Het
Slc25a33	T	A	4: 149,756,152	K79N	probably benign	Het
Slc25a51	A	C	4: 45,399,783	F136V	probably benign	Het
Slfn14	T	A	11: 83,283,293	K291*	probably null	Het
Sp100	A	G	1: 85,697,098	K403E	possibly damaging	Het
Spaca1	C	T	4: 34,049,837	E54K	possibly damaging	Het
Sympk	T	G	7: 19,053,448		probably null	Het
Syne1	A	T	10: 5,117,031	V7078D	probably damaging	Het
Tas2r121	T	A	6: 132,700,809	I67L	probably benign	Het
Tha1	T	C	11: 117,868,497	K389E	probably benign	Het
Thbs2	T	A	17: 14,680,322	Q541L	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem94	T	C	11: 115,788,392		probably null	Het
Tnfsf13	A	G	11: 69,685,157	C35R	probably damaging	Het
Trcg1	C	A	9: 57,242,281	Q379K	probably benign	Het
Ubr4	T	C	4: 139,440,696	S1507P	probably damaging	Het
Uckl1	A	G	2: 181,573,256	I268T	probably damaging	Het
Uvrag	T	C	7: 98,991,967	K289E	possibly damaging	Het
Vmn2r104	C	A	17: 20,030,221	C596F	possibly damaging	Het
Vmn2r11	A	T	5: 109,053,760	F293I	probably damaging	Het
Vps13b	T	A	15: 35,668,906		probably null	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zscan4f	T	A	7: 11,401,227	C187S	possibly damaging	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154402150	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154481665	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154442287	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154444947	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154407740	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATAGCTGGGATAACACTGGC -3'
(R):5'- TGTCTTACAATAAAGTGGAGTGGG -3'

Sequencing Primer
(F):5'- TAACACTGGCACAAGGGTCTG -3'
(R):5'- GAGGTAATGTTGAACTGTATCACGCC -3'

Posted On

2020-06-30