Incidental Mutation 'R8094:Cacna1e'
ID630038
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154561770 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 340 (S340F)
Ref Sequence ENSEMBL: ENSMUSP00000140937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect probably damaging
Transcript: ENSMUST00000004214
AA Change: S32F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: S32F

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187541
AA Change: S340F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: S340F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211821
AA Change: S278F

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154561806 missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154403683 missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4727:Cacna1e UTSW 1 154436468 nonsense probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154725709 missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 splice site probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154725801 missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154472234 missense probably benign 0.13
R7502:Cacna1e UTSW 1 154468988 missense probably null 0.35
R7556:Cacna1e UTSW 1 154472673 missense probably benign 0.28
R7563:Cacna1e UTSW 1 154471416 missense probably benign 0.00
R7573:Cacna1e UTSW 1 154726165 intron probably benign
R7689:Cacna1e UTSW 1 154398803 missense probably benign 0.01
R7699:Cacna1e UTSW 1 154443928 missense probably damaging 1.00
R7744:Cacna1e UTSW 1 154465792 missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154413117 missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154482568 missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154398406 missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154471403 missense probably benign 0.08
R7849:Cacna1e UTSW 1 154633718 missense probably damaging 1.00
R8011:Cacna1e UTSW 1 154465822 missense probably benign 0.01
R8162:Cacna1e UTSW 1 154701567 splice site probably null
R8202:Cacna1e UTSW 1 154398449 missense probably benign
R8280:Cacna1e UTSW 1 154469093 missense probably damaging 0.97
R8354:Cacna1e UTSW 1 154398568 missense probably damaging 1.00
R8385:Cacna1e UTSW 1 154443941 missense probably damaging 0.98
R8532:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R8902:Cacna1e UTSW 1 154473886 missense probably benign 0.01
R8926:Cacna1e UTSW 1 154701334 missense possibly damaging 0.84
R8947:Cacna1e UTSW 1 154402150 missense probably benign 0.10
RF008:Cacna1e UTSW 1 154442136 missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Z1176:Cacna1e UTSW 1 154635850 missense probably damaging 0.98
Z1177:Cacna1e UTSW 1 154442292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGCTGGGATAACACTGGC -3'
(R):5'- TGTCTTACAATAAAGTGGAGTGGG -3'

Sequencing Primer
(F):5'- TAACACTGGCACAAGGGTCTG -3'
(R):5'- GAGGTAATGTTGAACTGTATCACGCC -3'
Posted On2020-06-30