Incidental Mutation 'R8094:Olfr3'
ID630042
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36812318 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 258 (L258H)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect probably damaging
Transcript: ENSMUST00000100151
AA Change: L258H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: L258H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213988
AA Change: L258H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R0890:Olfr3 UTSW 2 36812574 missense probably benign 0.06
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R3435:Olfr3 UTSW 2 36812678 missense probably benign 0.06
R4378:Olfr3 UTSW 2 36812469 missense probably benign
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4626:Olfr3 UTSW 2 36812259 missense probably damaging 0.98
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7003:Olfr3 UTSW 2 36813035 missense possibly damaging 0.51
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGCAAAGCATTCAGAGGG -3'
(R):5'- AGGTTTGGCCGCCATTATG -3'

Sequencing Primer
(F):5'- CATTCAGAGGGAGAGCAGTAAATG -3'
(R):5'- GGCCGCCATTATGCTTCCG -3'
Posted On2020-06-30