Incidental Mutation 'R8094:Olfr1215'
ID630045
Institutional Source Beutler Lab
Gene Symbol Olfr1215
Ensembl Gene ENSMUSG00000100016
Gene Nameolfactory receptor 1215
SynonymsGA_x6K02T2Q125-50482823-50481885, MOR233-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89000021-89006973 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 89002368 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188399] [ENSMUST00000214809] [ENSMUST00000216271]
Predicted Effect probably benign
Transcript: ENSMUST00000188399
SMART Domains Protein: ENSMUSP00000141134
Gene: ENSMUSG00000100016

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 286 1.9e-25 PFAM
Pfam:7tm_4 138 283 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214809
Predicted Effect probably benign
Transcript: ENSMUST00000216271
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Olfr1215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr1215 APN 2 89001339 utr 3 prime probably benign
IGL02395:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02399:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02409:Olfr1215 APN 2 89001910 missense possibly damaging 0.75
IGL02421:Olfr1215 APN 2 89001344 unclassified probably null
IGL03036:Olfr1215 APN 2 89002115 missense possibly damaging 0.94
R2036:Olfr1215 UTSW 2 89001632 missense probably damaging 0.97
R2199:Olfr1215 UTSW 2 89001550 missense probably damaging 0.98
R3930:Olfr1215 UTSW 2 89002033 missense probably benign 0.32
R4990:Olfr1215 UTSW 2 89001472 missense probably damaging 0.97
R5199:Olfr1215 UTSW 2 89001763 missense possibly damaging 0.70
R5368:Olfr1215 UTSW 2 89002091 missense probably damaging 1.00
R5396:Olfr1215 UTSW 2 89002196 missense probably benign 0.15
R6881:Olfr1215 UTSW 2 89001937 missense probably damaging 1.00
R7195:Olfr1215 UTSW 2 89001731 missense
R7425:Olfr1215 UTSW 2 89002200 missense
R7804:Olfr1215 UTSW 2 89001511 missense unknown
Z1088:Olfr1215 UTSW 2 89001838 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACCACAATTGTCATGTTGCC -3'
(R):5'- TTTTCTAGCACATACAGAGAGGTTC -3'

Sequencing Primer
(F):5'- GCCTCCAATTGTTGCAAGATAGAGC -3'
(R):5'- CAGAGAGGTTCTGCTACAATATTTG -3'
Posted On2020-06-30