Incidental Mutation 'R8094:Ptpru'
ID630058
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131793592 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 801 (T801I)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030741
AA Change: T811I

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: T811I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097860
AA Change: T739I

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: T739I

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000105987
AA Change: T801I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: T801I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGCAGCCTCTAAGCACAGTG -3'
(R):5'- TGTAGACTTCCCGACTCCAAGG -3'

Sequencing Primer
(F):5'- ATTCTCTGGATTTCTGTGCCAATG -3'
(R):5'- GACTCCAAGGCTCCCAGAG -3'
Posted On2020-06-30