Incidental Mutation 'R8094:Fat1'
ID 630081
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene Name FAT atypical cadherin 1
Synonyms 2310038E12Rik, mFat1, Fath
MMRRC Submission 067526-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8094 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 45388484-45505294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45405739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 830 (V830A)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000098796
AA Change: V830A

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: V830A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000191428
AA Change: V830A

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: V830A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: V830A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,329,824 (GRCm39) L93H unknown Het
A2ml1 A G 6: 128,549,045 (GRCm39) Y246H probably damaging Het
Akap11 C A 14: 78,750,413 (GRCm39) C658F Het
Arid2 T G 15: 96,266,592 (GRCm39) S547A possibly damaging Het
Atf1 C A 15: 100,143,170 (GRCm39) D46E probably damaging Het
Brca2 T A 5: 150,459,634 (GRCm39) F303Y possibly damaging Het
Btbd18 T A 2: 84,498,260 (GRCm39) S633T possibly damaging Het
Btg4 T G 9: 51,030,445 (GRCm39) F182V probably benign Het
Cacna1e G A 1: 154,437,516 (GRCm39) S340F probably damaging Het
Camta2 A G 11: 70,576,903 (GRCm39) W41R probably damaging Het
Cbl A T 9: 44,074,696 (GRCm39) D455E probably benign Het
Ccdc162 A T 10: 41,488,864 (GRCm39) D1208E probably benign Het
Cd177 A T 7: 24,443,842 (GRCm39) M752K probably damaging Het
Cep290 A T 10: 100,380,793 (GRCm39) H100L possibly damaging Het
Chrnb2 T A 3: 89,668,698 (GRCm39) I206F probably damaging Het
Cyp2c40 A G 19: 39,791,009 (GRCm39) L274S probably benign Het
Cyp2c40 T A 19: 39,791,015 (GRCm39) Y272F probably benign Het
Cyp2d22 C A 15: 82,258,556 (GRCm39) A102S probably benign Het
Cyp51 C T 5: 4,136,490 (GRCm39) E435K probably benign Het
Dchs2 T C 3: 83,262,929 (GRCm39) F3066L probably benign Het
Disp1 C A 1: 182,869,192 (GRCm39) R1076L probably damaging Het
Dkk2 C T 3: 131,791,801 (GRCm39) A3V probably benign Het
Dnah7b T C 1: 46,165,964 (GRCm39) F543S probably benign Het
Dpt A T 1: 164,624,481 (GRCm39) S61C probably damaging Het
Drg2 A T 11: 60,353,096 (GRCm39) Y243F probably damaging Het
Dsg2 A G 18: 20,716,061 (GRCm39) probably benign Het
Dst T G 1: 34,228,040 (GRCm39) L1878V possibly damaging Het
F5 A G 1: 164,036,509 (GRCm39) Y1890C probably benign Het
Fat2 C T 11: 55,186,965 (GRCm39) D1294N probably benign Het
Fbxo15 A G 18: 84,983,618 (GRCm39) Y322C probably benign Het
Fcsk A G 8: 111,622,604 (GRCm39) F108S probably damaging Het
Fhit A T 14: 10,751,666 (GRCm38) N7K unknown Het
Gabrb2 A G 11: 42,488,370 (GRCm39) I279V probably damaging Het
Galk2 T C 2: 125,773,189 (GRCm39) F207S probably damaging Het
Gtpbp3 C T 8: 71,941,480 (GRCm39) L17F possibly damaging Het
Gucy2c T A 6: 136,714,446 (GRCm39) D460V probably benign Het
Herc1 G A 9: 66,400,462 (GRCm39) V4329I probably damaging Het
Iqcn T C 8: 71,162,067 (GRCm39) V420A probably benign Het
Kirrel3 G A 9: 34,946,460 (GRCm39) V740M probably damaging Het
Macf1 C A 4: 123,263,660 (GRCm39) V6956L probably damaging Het
Mill1 C T 7: 17,989,835 (GRCm39) A39V probably benign Het
Mkln1 T A 6: 31,469,588 (GRCm39) Y599* probably null Het
Mrpl14 T A 17: 46,009,039 (GRCm39) L46Q possibly damaging Het
Myom2 G T 8: 15,119,418 (GRCm39) R103L possibly damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Ndst2 A T 14: 20,778,232 (GRCm39) V449D probably damaging Het
Nell1 T A 7: 49,770,335 (GRCm39) H131Q probably benign Het
Nos3 G C 5: 24,572,218 (GRCm39) R97P probably benign Het
Npc1 A T 18: 12,327,297 (GRCm39) F1099L probably benign Het
Nxpe5 T A 5: 138,249,802 (GRCm39) W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or1j1 A T 2: 36,702,330 (GRCm39) L258H probably damaging Het
Or4c110 T C 2: 88,832,712 (GRCm39) probably benign Het
Or5b98 A T 19: 12,931,366 (GRCm39) T138S probably benign Het
Or6c210 A G 10: 129,495,933 (GRCm39) D86G probably damaging Het
Osmr T C 15: 6,845,102 (GRCm39) N889S possibly damaging Het
Oxct2b A G 4: 123,010,301 (GRCm39) I74V possibly damaging Het
Pakap A G 4: 57,886,319 (GRCm39) T859A possibly damaging Het
Phldb3 C A 7: 24,326,134 (GRCm39) A572D probably damaging Het
Pigr A G 1: 130,774,247 (GRCm39) E409G probably damaging Het
Ptprs T C 17: 56,735,947 (GRCm39) E674G probably benign Het
Ptpru G A 4: 131,520,903 (GRCm39) T801I possibly damaging Het
Ralgapa1 T A 12: 55,829,631 (GRCm39) D200V probably damaging Het
Rb1cc1 A T 1: 6,333,448 (GRCm39) R1429* probably null Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnpep A T 1: 135,211,514 (GRCm39) L78Q probably damaging Het
Rtn2 A T 7: 19,027,791 (GRCm39) I394F probably damaging Het
Satb2 A T 1: 56,870,623 (GRCm39) V572D possibly damaging Het
Sds T C 5: 120,617,001 (GRCm39) probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,595,032 (GRCm39) probably benign Het
Sgo2a T C 1: 58,056,300 (GRCm39) I828T possibly damaging Het
Slc25a33 T A 4: 149,840,609 (GRCm39) K79N probably benign Het
Slc25a51 A C 4: 45,399,783 (GRCm39) F136V probably benign Het
Slfn14 T A 11: 83,174,119 (GRCm39) K291* probably null Het
Sp100 A G 1: 85,624,819 (GRCm39) K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 (GRCm39) E54K possibly damaging Het
Sympk T G 7: 18,787,373 (GRCm39) probably null Het
Syne1 A T 10: 5,067,031 (GRCm39) V7078D probably damaging Het
Tas2r121 T A 6: 132,677,772 (GRCm39) I67L probably benign Het
Tha1 T C 11: 117,759,323 (GRCm39) K389E probably benign Het
Thbs2 T A 17: 14,900,584 (GRCm39) Q541L probably benign Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmem94 T C 11: 115,679,218 (GRCm39) probably null Het
Tnfsf13 A G 11: 69,575,983 (GRCm39) C35R probably damaging Het
Trcg1 C A 9: 57,149,564 (GRCm39) Q379K probably benign Het
Ubr4 T C 4: 139,168,007 (GRCm39) S1507P probably damaging Het
Uckl1 A G 2: 181,215,049 (GRCm39) I268T probably damaging Het
Uvrag T C 7: 98,641,174 (GRCm39) K289E possibly damaging Het
Vmn2r104 C A 17: 20,250,483 (GRCm39) C596F possibly damaging Het
Vmn2r11 A T 5: 109,201,626 (GRCm39) F293I probably damaging Het
Vps13b T A 15: 35,669,052 (GRCm39) probably null Het
Wipf1 G A 2: 73,267,879 (GRCm39) P173L possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zscan4f T A 7: 11,135,154 (GRCm39) C187S possibly damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45,477,639 (GRCm39) missense possibly damaging 0.93
IGL00157:Fat1 APN 8 45,404,707 (GRCm39) missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45,503,977 (GRCm39) missense probably benign 0.18
IGL00983:Fat1 APN 8 45,486,427 (GRCm39) missense probably damaging 1.00
IGL01089:Fat1 APN 8 45,470,894 (GRCm39) missense probably damaging 1.00
IGL01135:Fat1 APN 8 45,477,877 (GRCm39) missense probably damaging 1.00
IGL01143:Fat1 APN 8 45,488,569 (GRCm39) missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45,476,986 (GRCm39) missense probably damaging 1.00
IGL01376:Fat1 APN 8 45,479,878 (GRCm39) missense probably benign 0.00
IGL01411:Fat1 APN 8 45,479,837 (GRCm39) missense probably damaging 1.00
IGL01443:Fat1 APN 8 45,493,613 (GRCm39) missense probably damaging 1.00
IGL01453:Fat1 APN 8 45,504,307 (GRCm39) missense probably damaging 1.00
IGL01606:Fat1 APN 8 45,476,086 (GRCm39) missense probably benign 0.26
IGL01622:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45,493,737 (GRCm39) missense probably benign 0.05
IGL01735:Fat1 APN 8 45,489,276 (GRCm39) missense probably benign 0.07
IGL01793:Fat1 APN 8 45,442,149 (GRCm39) missense probably benign
IGL01820:Fat1 APN 8 45,463,539 (GRCm39) missense probably damaging 1.00
IGL01969:Fat1 APN 8 45,405,636 (GRCm39) missense probably damaging 0.98
IGL02012:Fat1 APN 8 45,480,577 (GRCm39) missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45,476,696 (GRCm39) missense probably damaging 1.00
IGL02256:Fat1 APN 8 45,403,369 (GRCm39) missense probably damaging 1.00
IGL02273:Fat1 APN 8 45,403,368 (GRCm39) missense probably damaging 1.00
IGL02317:Fat1 APN 8 45,478,855 (GRCm39) missense probably benign 0.33
IGL02324:Fat1 APN 8 45,493,593 (GRCm39) missense probably damaging 1.00
IGL02336:Fat1 APN 8 45,404,620 (GRCm39) missense probably benign 0.16
IGL02442:Fat1 APN 8 45,403,360 (GRCm39) missense probably benign 0.02
IGL02486:Fat1 APN 8 45,478,109 (GRCm39) missense probably benign 0.16
IGL02551:Fat1 APN 8 45,504,435 (GRCm39) missense probably damaging 1.00
IGL02617:Fat1 APN 8 45,488,628 (GRCm39) missense probably benign 0.31
IGL02698:Fat1 APN 8 45,476,201 (GRCm39) missense probably benign
IGL02885:Fat1 APN 8 45,442,204 (GRCm39) missense probably benign 0.01
IGL02904:Fat1 APN 8 45,493,719 (GRCm39) missense probably damaging 1.00
IGL02953:Fat1 APN 8 45,477,351 (GRCm39) missense probably damaging 1.00
IGL03108:Fat1 APN 8 45,476,651 (GRCm39) missense probably damaging 1.00
IGL03153:Fat1 APN 8 45,483,160 (GRCm39) missense possibly damaging 0.83
IGL03183:Fat1 APN 8 45,403,623 (GRCm39) missense probably damaging 0.99
IGL03327:Fat1 APN 8 45,403,505 (GRCm39) missense probably damaging 1.00
IGL03405:Fat1 APN 8 45,478,278 (GRCm39) missense probably damaging 1.00
Laggardly UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R2257_fat1_465 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
Shrinkage UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
F5493:Fat1 UTSW 8 45,478,517 (GRCm39) missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
I2289:Fat1 UTSW 8 45,478,033 (GRCm39) missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45,470,471 (GRCm39) missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45,490,244 (GRCm39) missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45,482,577 (GRCm39) missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45,477,682 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0078:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R0197:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0328:Fat1 UTSW 8 45,476,827 (GRCm39) missense probably benign 0.35
R0367:Fat1 UTSW 8 45,477,350 (GRCm39) missense probably damaging 1.00
R0371:Fat1 UTSW 8 45,404,929 (GRCm39) missense probably damaging 1.00
R0380:Fat1 UTSW 8 45,463,160 (GRCm39) missense probably damaging 0.97
R0389:Fat1 UTSW 8 45,403,385 (GRCm39) missense probably benign 0.00
R0433:Fat1 UTSW 8 45,477,686 (GRCm39) missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45,482,571 (GRCm39) missense probably damaging 1.00
R0494:Fat1 UTSW 8 45,403,579 (GRCm39) missense probably damaging 1.00
R0506:Fat1 UTSW 8 45,475,988 (GRCm39) missense probably damaging 0.99
R0512:Fat1 UTSW 8 45,404,369 (GRCm39) nonsense probably null
R0624:Fat1 UTSW 8 45,504,205 (GRCm39) missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0723:Fat1 UTSW 8 45,479,786 (GRCm39) missense probably damaging 1.00
R0787:Fat1 UTSW 8 45,493,592 (GRCm39) missense probably damaging 1.00
R0788:Fat1 UTSW 8 45,477,020 (GRCm39) missense probably benign 0.27
R0862:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0864:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0907:Fat1 UTSW 8 45,479,635 (GRCm39) missense probably benign 0.08
R0962:Fat1 UTSW 8 45,486,363 (GRCm39) splice site probably benign
R1051:Fat1 UTSW 8 45,497,543 (GRCm39) missense probably damaging 1.00
R1156:Fat1 UTSW 8 45,492,927 (GRCm39) missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45,497,316 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1478:Fat1 UTSW 8 45,478,659 (GRCm39) missense probably damaging 0.99
R1482:Fat1 UTSW 8 45,406,281 (GRCm39) missense probably benign 0.04
R1496:Fat1 UTSW 8 45,486,427 (GRCm39) missense probably damaging 1.00
R1498:Fat1 UTSW 8 45,478,521 (GRCm39) nonsense probably null
R1508:Fat1 UTSW 8 45,479,899 (GRCm39) missense probably benign 0.01
R1577:Fat1 UTSW 8 45,476,420 (GRCm39) missense probably benign 0.30
R1646:Fat1 UTSW 8 45,471,079 (GRCm39) missense probably damaging 1.00
R1652:Fat1 UTSW 8 45,478,215 (GRCm39) nonsense probably null
R1656:Fat1 UTSW 8 45,478,567 (GRCm39) nonsense probably null
R1662:Fat1 UTSW 8 45,406,201 (GRCm39) missense probably benign 0.20
R1672:Fat1 UTSW 8 45,489,872 (GRCm39) missense probably damaging 1.00
R1704:Fat1 UTSW 8 45,478,613 (GRCm39) missense probably damaging 1.00
R1708:Fat1 UTSW 8 45,477,829 (GRCm39) missense probably damaging 1.00
R1710:Fat1 UTSW 8 45,463,519 (GRCm39) missense probably benign 0.00
R1812:Fat1 UTSW 8 45,489,840 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,491,386 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,406,341 (GRCm39) missense probably benign 0.01
R1883:Fat1 UTSW 8 45,504,184 (GRCm39) missense probably benign 0.17
R1893:Fat1 UTSW 8 45,476,893 (GRCm39) missense probably damaging 1.00
R1930:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45,486,963 (GRCm39) missense probably benign 0.00
R1957:Fat1 UTSW 8 45,493,719 (GRCm39) missense probably damaging 1.00
R1999:Fat1 UTSW 8 45,405,430 (GRCm39) missense probably damaging 0.96
R2019:Fat1 UTSW 8 45,476,783 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,479,741 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,477,369 (GRCm39) missense probably damaging 1.00
R2117:Fat1 UTSW 8 45,490,500 (GRCm39) missense probably benign 0.33
R2196:Fat1 UTSW 8 45,477,683 (GRCm39) missense probably damaging 1.00
R2204:Fat1 UTSW 8 45,476,737 (GRCm39) missense probably damaging 1.00
R2256:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2257:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2409:Fat1 UTSW 8 45,493,567 (GRCm39) splice site probably benign
R2416:Fat1 UTSW 8 45,479,420 (GRCm39) missense probably damaging 1.00
R3021:Fat1 UTSW 8 45,497,048 (GRCm39) missense probably damaging 1.00
R3108:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3109:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3196:Fat1 UTSW 8 45,404,905 (GRCm39) missense probably benign 0.00
R3683:Fat1 UTSW 8 45,470,975 (GRCm39) missense probably benign
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3733:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45,478,516 (GRCm39) missense probably damaging 0.97
R3905:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3907:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3908:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R4060:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4061:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4062:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4063:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4078:Fat1 UTSW 8 45,442,159 (GRCm39) missense probably damaging 0.99
R4105:Fat1 UTSW 8 45,489,888 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,503,981 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,463,474 (GRCm39) missense probably damaging 1.00
R4161:Fat1 UTSW 8 45,489,824 (GRCm39) missense probably benign 0.00
R4364:Fat1 UTSW 8 45,405,999 (GRCm39) missense probably benign 0.01
R4394:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4395:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4396:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4412:Fat1 UTSW 8 45,476,636 (GRCm39) missense probably damaging 0.99
R4542:Fat1 UTSW 8 45,494,931 (GRCm39) missense probably damaging 1.00
R4591:Fat1 UTSW 8 45,479,279 (GRCm39) missense probably benign
R4606:Fat1 UTSW 8 45,403,720 (GRCm39) missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45,478,184 (GRCm39) missense probably damaging 1.00
R4730:Fat1 UTSW 8 45,486,514 (GRCm39) missense probably damaging 1.00
R4778:Fat1 UTSW 8 45,491,363 (GRCm39) missense probably benign 0.04
R4824:Fat1 UTSW 8 45,442,151 (GRCm39) missense probably damaging 1.00
R4829:Fat1 UTSW 8 45,489,199 (GRCm39) missense probably damaging 1.00
R4832:Fat1 UTSW 8 45,466,102 (GRCm39) missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45,466,007 (GRCm39) missense probably benign 0.15
R4896:Fat1 UTSW 8 45,404,317 (GRCm39) missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45,476,000 (GRCm39) missense probably damaging 0.96
R4941:Fat1 UTSW 8 45,489,312 (GRCm39) missense probably benign 0.00
R5011:Fat1 UTSW 8 45,484,300 (GRCm39) critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45,476,417 (GRCm39) missense probably damaging 1.00
R5112:Fat1 UTSW 8 45,477,319 (GRCm39) missense probably damaging 1.00
R5151:Fat1 UTSW 8 45,404,851 (GRCm39) missense possibly damaging 0.74
R5161:Fat1 UTSW 8 45,405,549 (GRCm39) missense probably benign 0.00
R5162:Fat1 UTSW 8 45,478,846 (GRCm39) missense probably benign 0.02
R5353:Fat1 UTSW 8 45,489,168 (GRCm39) missense probably benign 0.13
R5425:Fat1 UTSW 8 45,478,922 (GRCm39) missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45,466,090 (GRCm39) missense probably damaging 1.00
R5479:Fat1 UTSW 8 45,489,912 (GRCm39) missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45,476,516 (GRCm39) missense probably damaging 0.99
R5569:Fat1 UTSW 8 45,492,873 (GRCm39) missense probably damaging 0.98
R5610:Fat1 UTSW 8 45,406,109 (GRCm39) nonsense probably null
R5734:Fat1 UTSW 8 45,504,246 (GRCm39) missense probably damaging 0.99
R5832:Fat1 UTSW 8 45,470,460 (GRCm39) missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45,504,166 (GRCm39) missense probably benign
R5886:Fat1 UTSW 8 45,486,432 (GRCm39) missense probably damaging 1.00
R5886:Fat1 UTSW 8 45,480,718 (GRCm39) critical splice donor site probably null
R5919:Fat1 UTSW 8 45,479,910 (GRCm39) critical splice donor site probably null
R5930:Fat1 UTSW 8 45,497,073 (GRCm39) missense probably benign 0.10
R5960:Fat1 UTSW 8 45,486,405 (GRCm39) missense probably damaging 1.00
R5988:Fat1 UTSW 8 45,482,493 (GRCm39) missense probably benign 0.00
R6166:Fat1 UTSW 8 45,405,522 (GRCm39) missense probably damaging 1.00
R6184:Fat1 UTSW 8 45,406,429 (GRCm39) missense probably benign 0.00
R6208:Fat1 UTSW 8 45,480,650 (GRCm39) missense probably damaging 0.99
R6351:Fat1 UTSW 8 45,486,532 (GRCm39) missense probably damaging 1.00
R6391:Fat1 UTSW 8 45,405,379 (GRCm39) missense possibly damaging 0.69
R6701:Fat1 UTSW 8 45,403,718 (GRCm39) missense probably damaging 1.00
R6702:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6703:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6704:Fat1 UTSW 8 45,477,410 (GRCm39) missense probably damaging 1.00
R6822:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R6852:Fat1 UTSW 8 45,488,635 (GRCm39) missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R6885:Fat1 UTSW 8 45,405,489 (GRCm39) missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45,504,060 (GRCm39) missense probably benign 0.00
R6927:Fat1 UTSW 8 45,477,532 (GRCm39) missense probably benign 0.41
R6964:Fat1 UTSW 8 45,496,982 (GRCm39) missense probably damaging 1.00
R7010:Fat1 UTSW 8 45,406,386 (GRCm39) nonsense probably null
R7062:Fat1 UTSW 8 45,403,253 (GRCm39) start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45,493,812 (GRCm39) missense probably benign 0.09
R7071:Fat1 UTSW 8 45,442,145 (GRCm39) missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45,484,505 (GRCm39) missense probably damaging 0.98
R7146:Fat1 UTSW 8 45,403,962 (GRCm39) missense probably benign
R7210:Fat1 UTSW 8 45,476,540 (GRCm39) missense probably damaging 1.00
R7227:Fat1 UTSW 8 45,463,646 (GRCm39) missense probably benign 0.08
R7270:Fat1 UTSW 8 45,490,475 (GRCm39) missense probably damaging 1.00
R7373:Fat1 UTSW 8 45,479,702 (GRCm39) missense probably damaging 1.00
R7390:Fat1 UTSW 8 45,405,511 (GRCm39) missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45,497,189 (GRCm39) missense probably benign 0.35
R7476:Fat1 UTSW 8 45,484,311 (GRCm39) missense probably benign 0.01
R7483:Fat1 UTSW 8 45,476,197 (GRCm39) missense probably benign 0.13
R7484:Fat1 UTSW 8 45,489,221 (GRCm39) missense probably damaging 1.00
R7526:Fat1 UTSW 8 45,476,464 (GRCm39) missense probably damaging 1.00
R7549:Fat1 UTSW 8 45,442,031 (GRCm39) missense probably benign 0.01
R7554:Fat1 UTSW 8 45,490,202 (GRCm39) missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45,462,887 (GRCm39) missense possibly damaging 0.95
R7652:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R7694:Fat1 UTSW 8 45,441,967 (GRCm39) critical splice acceptor site probably null
R7746:Fat1 UTSW 8 45,404,670 (GRCm39) missense probably damaging 0.96
R7762:Fat1 UTSW 8 45,490,374 (GRCm39) missense probably damaging 0.99
R7762:Fat1 UTSW 8 45,476,359 (GRCm39) missense probably damaging 1.00
R7782:Fat1 UTSW 8 45,403,948 (GRCm39) missense probably damaging 1.00
R7801:Fat1 UTSW 8 45,495,260 (GRCm39) missense probably damaging 1.00
R7807:Fat1 UTSW 8 45,495,010 (GRCm39) missense probably damaging 1.00
R7821:Fat1 UTSW 8 45,403,261 (GRCm39) missense probably benign
R7869:Fat1 UTSW 8 45,504,259 (GRCm39) missense probably benign 0.02
R8034:Fat1 UTSW 8 45,404,728 (GRCm39) missense probably benign 0.28
R8111:Fat1 UTSW 8 45,479,095 (GRCm39) missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45,492,993 (GRCm39) missense probably null
R8221:Fat1 UTSW 8 45,406,390 (GRCm39) missense
R8233:Fat1 UTSW 8 45,405,055 (GRCm39) missense
R8250:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R8279:Fat1 UTSW 8 45,483,384 (GRCm39) critical splice donor site probably null
R8726:Fat1 UTSW 8 45,477,206 (GRCm39) missense probably benign 0.23
R8875:Fat1 UTSW 8 45,493,600 (GRCm39) missense probably damaging 1.00
R8937:Fat1 UTSW 8 45,483,350 (GRCm39) missense probably damaging 1.00
R8950:Fat1 UTSW 8 45,476,158 (GRCm39) missense probably damaging 1.00
R8971:Fat1 UTSW 8 45,495,331 (GRCm39) missense probably damaging 1.00
R8976:Fat1 UTSW 8 45,484,332 (GRCm39) missense probably benign 0.02
R9000:Fat1 UTSW 8 45,497,587 (GRCm39) nonsense probably null
R9032:Fat1 UTSW 8 45,492,894 (GRCm39) missense probably benign 0.01
R9076:Fat1 UTSW 8 45,492,938 (GRCm39) missense probably damaging 1.00
R9083:Fat1 UTSW 8 45,491,336 (GRCm39) missense probably benign 0.00
R9083:Fat1 UTSW 8 45,466,127 (GRCm39) missense possibly damaging 0.76
R9103:Fat1 UTSW 8 45,404,850 (GRCm39) missense probably benign 0.38
R9124:Fat1 UTSW 8 45,478,064 (GRCm39) missense possibly damaging 0.48
R9124:Fat1 UTSW 8 45,403,363 (GRCm39) missense probably benign
R9128:Fat1 UTSW 8 45,462,878 (GRCm39) missense probably benign 0.14
R9148:Fat1 UTSW 8 45,405,682 (GRCm39) missense possibly damaging 0.81
R9162:Fat1 UTSW 8 45,404,352 (GRCm39) missense probably damaging 1.00
R9209:Fat1 UTSW 8 45,404,791 (GRCm39) missense possibly damaging 0.80
R9276:Fat1 UTSW 8 45,488,514 (GRCm39) missense probably damaging 0.99
R9303:Fat1 UTSW 8 45,463,498 (GRCm39) missense probably damaging 1.00
R9319:Fat1 UTSW 8 45,406,060 (GRCm39) missense probably damaging 1.00
R9392:Fat1 UTSW 8 45,476,228 (GRCm39) missense probably damaging 1.00
R9616:Fat1 UTSW 8 45,406,075 (GRCm39) missense probably damaging 0.99
R9712:Fat1 UTSW 8 45,470,417 (GRCm39) missense probably benign 0.05
R9756:Fat1 UTSW 8 45,496,974 (GRCm39) missense probably damaging 0.96
RF001:Fat1 UTSW 8 45,442,003 (GRCm39) missense probably benign 0.00
X0064:Fat1 UTSW 8 45,478,771 (GRCm39) missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45,476,844 (GRCm39) missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 45,489,875 (GRCm39) missense probably damaging 1.00
Z1176:Fat1 UTSW 8 45,476,633 (GRCm39) missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 45,403,635 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCGTCTATGCTATTTCTGGAG -3'
(R):5'- CACTTCACGATCCAAAGGCTG -3'

Sequencing Primer
(F):5'- GATAGTTGCTTTACCATCGACATG -3'
(R):5'- GGCTGGATAATTTTCACCACACCG -3'
Posted On 2020-06-30