Incidental Mutation 'R8094:Cep290'
ID 630092
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 067526-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R8094 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100380793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 100 (H100L)
Ref Sequence ENSEMBL: ENSMUSP00000151414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: H1677L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: H1677L

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219408
AA Change: H100L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: H1670L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: H1677L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,329,824 (GRCm39) L93H unknown Het
A2ml1 A G 6: 128,549,045 (GRCm39) Y246H probably damaging Het
Akap11 C A 14: 78,750,413 (GRCm39) C658F Het
Arid2 T G 15: 96,266,592 (GRCm39) S547A possibly damaging Het
Atf1 C A 15: 100,143,170 (GRCm39) D46E probably damaging Het
Brca2 T A 5: 150,459,634 (GRCm39) F303Y possibly damaging Het
Btbd18 T A 2: 84,498,260 (GRCm39) S633T possibly damaging Het
Btg4 T G 9: 51,030,445 (GRCm39) F182V probably benign Het
Cacna1e G A 1: 154,437,516 (GRCm39) S340F probably damaging Het
Camta2 A G 11: 70,576,903 (GRCm39) W41R probably damaging Het
Cbl A T 9: 44,074,696 (GRCm39) D455E probably benign Het
Ccdc162 A T 10: 41,488,864 (GRCm39) D1208E probably benign Het
Cd177 A T 7: 24,443,842 (GRCm39) M752K probably damaging Het
Chrnb2 T A 3: 89,668,698 (GRCm39) I206F probably damaging Het
Cyp2c40 A G 19: 39,791,009 (GRCm39) L274S probably benign Het
Cyp2c40 T A 19: 39,791,015 (GRCm39) Y272F probably benign Het
Cyp2d22 C A 15: 82,258,556 (GRCm39) A102S probably benign Het
Cyp51 C T 5: 4,136,490 (GRCm39) E435K probably benign Het
Dchs2 T C 3: 83,262,929 (GRCm39) F3066L probably benign Het
Disp1 C A 1: 182,869,192 (GRCm39) R1076L probably damaging Het
Dkk2 C T 3: 131,791,801 (GRCm39) A3V probably benign Het
Dnah7b T C 1: 46,165,964 (GRCm39) F543S probably benign Het
Dpt A T 1: 164,624,481 (GRCm39) S61C probably damaging Het
Drg2 A T 11: 60,353,096 (GRCm39) Y243F probably damaging Het
Dsg2 A G 18: 20,716,061 (GRCm39) probably benign Het
Dst T G 1: 34,228,040 (GRCm39) L1878V possibly damaging Het
F5 A G 1: 164,036,509 (GRCm39) Y1890C probably benign Het
Fat1 T C 8: 45,405,739 (GRCm39) V830A probably damaging Het
Fat2 C T 11: 55,186,965 (GRCm39) D1294N probably benign Het
Fbxo15 A G 18: 84,983,618 (GRCm39) Y322C probably benign Het
Fcsk A G 8: 111,622,604 (GRCm39) F108S probably damaging Het
Fhit A T 14: 10,751,666 (GRCm38) N7K unknown Het
Gabrb2 A G 11: 42,488,370 (GRCm39) I279V probably damaging Het
Galk2 T C 2: 125,773,189 (GRCm39) F207S probably damaging Het
Gtpbp3 C T 8: 71,941,480 (GRCm39) L17F possibly damaging Het
Gucy2c T A 6: 136,714,446 (GRCm39) D460V probably benign Het
Herc1 G A 9: 66,400,462 (GRCm39) V4329I probably damaging Het
Iqcn T C 8: 71,162,067 (GRCm39) V420A probably benign Het
Kirrel3 G A 9: 34,946,460 (GRCm39) V740M probably damaging Het
Macf1 C A 4: 123,263,660 (GRCm39) V6956L probably damaging Het
Mill1 C T 7: 17,989,835 (GRCm39) A39V probably benign Het
Mkln1 T A 6: 31,469,588 (GRCm39) Y599* probably null Het
Mrpl14 T A 17: 46,009,039 (GRCm39) L46Q possibly damaging Het
Myom2 G T 8: 15,119,418 (GRCm39) R103L possibly damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Ndst2 A T 14: 20,778,232 (GRCm39) V449D probably damaging Het
Nell1 T A 7: 49,770,335 (GRCm39) H131Q probably benign Het
Nos3 G C 5: 24,572,218 (GRCm39) R97P probably benign Het
Npc1 A T 18: 12,327,297 (GRCm39) F1099L probably benign Het
Nxpe5 T A 5: 138,249,802 (GRCm39) W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or1j1 A T 2: 36,702,330 (GRCm39) L258H probably damaging Het
Or4c110 T C 2: 88,832,712 (GRCm39) probably benign Het
Or5b98 A T 19: 12,931,366 (GRCm39) T138S probably benign Het
Or6c210 A G 10: 129,495,933 (GRCm39) D86G probably damaging Het
Osmr T C 15: 6,845,102 (GRCm39) N889S possibly damaging Het
Oxct2b A G 4: 123,010,301 (GRCm39) I74V possibly damaging Het
Pakap A G 4: 57,886,319 (GRCm39) T859A possibly damaging Het
Phldb3 C A 7: 24,326,134 (GRCm39) A572D probably damaging Het
Pigr A G 1: 130,774,247 (GRCm39) E409G probably damaging Het
Ptprs T C 17: 56,735,947 (GRCm39) E674G probably benign Het
Ptpru G A 4: 131,520,903 (GRCm39) T801I possibly damaging Het
Ralgapa1 T A 12: 55,829,631 (GRCm39) D200V probably damaging Het
Rb1cc1 A T 1: 6,333,448 (GRCm39) R1429* probably null Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnpep A T 1: 135,211,514 (GRCm39) L78Q probably damaging Het
Rtn2 A T 7: 19,027,791 (GRCm39) I394F probably damaging Het
Satb2 A T 1: 56,870,623 (GRCm39) V572D possibly damaging Het
Sds T C 5: 120,617,001 (GRCm39) probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,595,032 (GRCm39) probably benign Het
Sgo2a T C 1: 58,056,300 (GRCm39) I828T possibly damaging Het
Slc25a33 T A 4: 149,840,609 (GRCm39) K79N probably benign Het
Slc25a51 A C 4: 45,399,783 (GRCm39) F136V probably benign Het
Slfn14 T A 11: 83,174,119 (GRCm39) K291* probably null Het
Sp100 A G 1: 85,624,819 (GRCm39) K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 (GRCm39) E54K possibly damaging Het
Sympk T G 7: 18,787,373 (GRCm39) probably null Het
Syne1 A T 10: 5,067,031 (GRCm39) V7078D probably damaging Het
Tas2r121 T A 6: 132,677,772 (GRCm39) I67L probably benign Het
Tha1 T C 11: 117,759,323 (GRCm39) K389E probably benign Het
Thbs2 T A 17: 14,900,584 (GRCm39) Q541L probably benign Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmem94 T C 11: 115,679,218 (GRCm39) probably null Het
Tnfsf13 A G 11: 69,575,983 (GRCm39) C35R probably damaging Het
Trcg1 C A 9: 57,149,564 (GRCm39) Q379K probably benign Het
Ubr4 T C 4: 139,168,007 (GRCm39) S1507P probably damaging Het
Uckl1 A G 2: 181,215,049 (GRCm39) I268T probably damaging Het
Uvrag T C 7: 98,641,174 (GRCm39) K289E possibly damaging Het
Vmn2r104 C A 17: 20,250,483 (GRCm39) C596F possibly damaging Het
Vmn2r11 A T 5: 109,201,626 (GRCm39) F293I probably damaging Het
Vps13b T A 15: 35,669,052 (GRCm39) probably null Het
Wipf1 G A 2: 73,267,879 (GRCm39) P173L possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zscan4f T A 7: 11,135,154 (GRCm39) C187S possibly damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGAGTATGTAAGTAGCTGCCAC -3'
(R):5'- TTCTCTTTCAAGGCTAGTTGGC -3'

Sequencing Primer
(F):5'- TAGAGCTCACTGGACAGTCTACG -3'
(R):5'- GCTCTTTAGCCTGTCTACAAGATTC -3'
Posted On 2020-06-30