Incidental Mutation 'R8094:Gabrb2'
ID630094
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 2
SynonymsC030002O17Rik, C030021G16Rik, Gabrb-2
MMRRC Submission
Accession Numbers

Genbank: NM_008070

Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location42419757-42629028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42597543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 279 (I279V)
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
Predicted Effect probably damaging
Transcript: ENSMUST00000007797
AA Change: I279V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: I279V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192403
AA Change: I279V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: I279V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Tha1 T C 11: 117,868,497 K389E probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42591894 missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42529495 critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42421400 missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42591944 missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42421431 splice site probably benign
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42487314 missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42529471 missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42591888 missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42626713 missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42593832 missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42421428 critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42591864 missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42591907 missense probably benign
R2993:Gabrb2 UTSW 11 42597649 missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42626881 missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4168:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4497:Gabrb2 UTSW 11 42597694 missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42593917 missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42597642 missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42529503 splice site probably benign
R5345:Gabrb2 UTSW 11 42626809 missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42421389 missense probably benign
R5575:Gabrb2 UTSW 11 42529538 intron probably benign
R5701:Gabrb2 UTSW 11 42487374 missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42421389 missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42626869 missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42593931 missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42597613 missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42626661 missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42593931 missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42626742 missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42487212 missense probably damaging 1.00
R7866:Gabrb2 UTSW 11 42487223 nonsense probably null
R8402:Gabrb2 UTSW 11 42487304 missense probably damaging 1.00
RF008:Gabrb2 UTSW 11 42626878 missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42422646 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTCCCTGGTTGATTAAGCAAC -3'
(R):5'- GGTCCTCTCCCAAAGAAGATG -3'

Sequencing Primer
(F):5'- AGCAACAGCCACTAATTTTTCAG -3'
(R):5'- GTCCTCTCCCAAAGAAGATGTAGTTG -3'
Posted On2020-06-30