Incidental Mutation 'R0701:Bsph1'
ID63010
Institutional Source Beutler Lab
Gene Symbol Bsph1
Ensembl Gene ENSMUSG00000074378
Gene Namebinder of sperm protein homolog 1
SynonymsLOC330470
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0701 (G1)
Quality Score159
Status Not validated
Chromosome7
Chromosomal Location13450841-13473449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13472256 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 72 (C72F)
Ref Sequence ENSEMBL: ENSMUSP00000144997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098811] [ENSMUST00000204715]
Predicted Effect probably damaging
Transcript: ENSMUST00000098811
AA Change: C82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096408
Gene: ENSMUSG00000074378
AA Change: C82F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 39 82 1.36e-6 SMART
FN2 83 131 2.29e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204715
AA Change: C72F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144997
Gene: ENSMUSG00000074378
AA Change: C72F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 28 72 3.47e-6 SMART
FN2 73 121 2.29e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the binder of sperm family. The encoded protein may be involved in sperm capacitation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Bsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03131:Bsph1 APN 7 13473087 missense probably damaging 1.00
R0334:Bsph1 UTSW 7 13450939 nonsense probably null
R0684:Bsph1 UTSW 7 13473063 missense probably damaging 1.00
R0905:Bsph1 UTSW 7 13450914 start codon destroyed probably benign 0.33
R1087:Bsph1 UTSW 7 13472181 missense probably damaging 1.00
R2189:Bsph1 UTSW 7 13470329 critical splice donor site probably null
R3427:Bsph1 UTSW 7 13472243 missense probably damaging 1.00
R4043:Bsph1 UTSW 7 13458276 critical splice donor site probably null
R4718:Bsph1 UTSW 7 13472182 nonsense probably null
R4726:Bsph1 UTSW 7 13472995 missense probably benign 0.00
R5571:Bsph1 UTSW 7 13450915 start codon destroyed probably null 0.86
R6852:Bsph1 UTSW 7 13470330 critical splice donor site probably null
R6903:Bsph1 UTSW 7 13458258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTGATGCTAGGCAGCTC -3'
(R):5'- ATGTGCTCTCATTCAACAGCAACAAAG -3'

Sequencing Primer
(F):5'- ctctcctttccatccttctgac -3'
(R):5'- CAACAAAGAAGTTGTGTGCCTC -3'
Posted On2013-07-30