Incidental Mutation 'R8094:Tha1'
ID630101
Institutional Source Beutler Lab
Gene Symbol Tha1
Ensembl Gene ENSMUSG00000017713
Gene Namethreonine aldolase 1
SynonymsGLY1, 1300017K07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8094 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location117867952-117873481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117868497 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 389 (K389E)
Ref Sequence ENSEMBL: ENSMUSP00000033230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033230] [ENSMUST00000093905]
Predicted Effect probably benign
Transcript: ENSMUST00000033230
AA Change: K389E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000033230
Gene: ENSMUSG00000017713
AA Change: K389E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Beta_elim_lyase 42 334 4.6e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093905
SMART Domains Protein: ENSMUSP00000091432
Gene: ENSMUSG00000070330

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 190 9.7e-14 PFAM
Pfam:Claudin_2 16 192 1.3e-45 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik T A 8: 12,279,824 L93H unknown Het
A2ml1 A G 6: 128,572,082 Y246H probably damaging Het
Akap11 C A 14: 78,512,973 C658F Het
Akap2 A G 4: 57,886,319 T859A possibly damaging Het
Arid2 T G 15: 96,368,711 S547A possibly damaging Het
Atf1 C A 15: 100,245,289 D46E probably damaging Het
Brca2 T A 5: 150,536,169 F303Y possibly damaging Het
Btbd18 T A 2: 84,667,916 S633T possibly damaging Het
Btg4 T G 9: 51,119,145 F182V probably benign Het
Cacna1e G A 1: 154,561,770 S340F probably damaging Het
Camta2 A G 11: 70,686,077 W41R probably damaging Het
Cbl A T 9: 44,163,399 D455E probably benign Het
Ccdc162 A T 10: 41,612,868 D1208E probably benign Het
Cd177 A T 7: 24,744,417 M752K probably damaging Het
Cep290 A T 10: 100,544,931 H100L possibly damaging Het
Chrnb2 T A 3: 89,761,391 I206F probably damaging Het
Cyp2c40 A G 19: 39,802,565 L274S probably benign Het
Cyp2c40 T A 19: 39,802,571 Y272F probably benign Het
Cyp2d22 C A 15: 82,374,355 A102S probably benign Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dchs2 T C 3: 83,355,622 F3066L probably benign Het
Disp1 C A 1: 183,087,628 R1076L probably damaging Het
Dkk2 C T 3: 132,086,040 A3V probably benign Het
Dnah7b T C 1: 46,126,804 F543S probably benign Het
Dpt A T 1: 164,796,912 S61C probably damaging Het
Drg2 A T 11: 60,462,270 Y243F probably damaging Het
Dsg2 A G 18: 20,583,004 probably benign Het
Dst T G 1: 34,188,959 L1878V possibly damaging Het
F5 A G 1: 164,208,940 Y1890C probably benign Het
Fat1 T C 8: 44,952,702 V830A probably damaging Het
Fat2 C T 11: 55,296,139 D1294N probably benign Het
Fbxo15 A G 18: 84,965,493 Y322C probably benign Het
Fhit A T 14: 10,751,666 N7K unknown Het
Fuk A G 8: 110,895,972 F108S probably damaging Het
Gabrb2 A G 11: 42,597,543 I279V probably damaging Het
Galk2 T C 2: 125,931,269 F207S probably damaging Het
Gm16486 T C 8: 70,709,418 V420A probably benign Het
Gtpbp3 C T 8: 71,488,836 L17F possibly damaging Het
Gucy2c T A 6: 136,737,448 D460V probably benign Het
Herc1 G A 9: 66,493,180 V4329I probably damaging Het
Kirrel3 G A 9: 35,035,164 V740M probably damaging Het
Macf1 C A 4: 123,369,867 V6956L probably damaging Het
Mill1 C T 7: 18,255,910 A39V probably benign Het
Mkln1 T A 6: 31,492,653 Y599* probably null Het
Mrpl14 T A 17: 45,698,113 L46Q possibly damaging Het
Myom2 G T 8: 15,069,418 R103L possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndst2 A T 14: 20,728,164 V449D probably damaging Het
Nell1 T A 7: 50,120,587 H131Q probably benign Het
Nos3 G C 5: 24,367,220 R97P probably benign Het
Npc1 A T 18: 12,194,240 F1099L probably benign Het
Nxpe5 T A 5: 138,251,540 W531R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1215 T C 2: 89,002,368 probably benign Het
Olfr1450 A T 19: 12,954,002 T138S probably benign Het
Olfr3 A T 2: 36,812,318 L258H probably damaging Het
Olfr800 A G 10: 129,660,064 D86G probably damaging Het
Osmr T C 15: 6,815,621 N889S possibly damaging Het
Oxct2b A G 4: 123,116,508 I74V possibly damaging Het
Phldb3 C A 7: 24,626,709 A572D probably damaging Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Ptprs T C 17: 56,428,947 E674G probably benign Het
Ptpru G A 4: 131,793,592 T801I possibly damaging Het
Ralgapa1 T A 12: 55,782,846 D200V probably damaging Het
Rb1cc1 A T 1: 6,263,224 R1429* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnpep A T 1: 135,283,776 L78Q probably damaging Het
Rtn2 A T 7: 19,293,866 I394F probably damaging Het
Satb2 A T 1: 56,831,464 V572D possibly damaging Het
Sds T C 5: 120,478,936 probably benign Het
Serpina10 TTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCC 12: 103,628,773 probably benign Het
Sgo2a T C 1: 58,017,141 I828T possibly damaging Het
Slc25a33 T A 4: 149,756,152 K79N probably benign Het
Slc25a51 A C 4: 45,399,783 F136V probably benign Het
Slfn14 T A 11: 83,283,293 K291* probably null Het
Sp100 A G 1: 85,697,098 K403E possibly damaging Het
Spaca1 C T 4: 34,049,837 E54K possibly damaging Het
Sympk T G 7: 19,053,448 probably null Het
Syne1 A T 10: 5,117,031 V7078D probably damaging Het
Tas2r121 T A 6: 132,700,809 I67L probably benign Het
Thbs2 T A 17: 14,680,322 Q541L probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem94 T C 11: 115,788,392 probably null Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trcg1 C A 9: 57,242,281 Q379K probably benign Het
Ubr4 T C 4: 139,440,696 S1507P probably damaging Het
Uckl1 A G 2: 181,573,256 I268T probably damaging Het
Uvrag T C 7: 98,991,967 K289E possibly damaging Het
Vmn2r104 C A 17: 20,030,221 C596F possibly damaging Het
Vmn2r11 A T 5: 109,053,760 F293I probably damaging Het
Vps13b T A 15: 35,668,906 probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zscan4f T A 7: 11,401,227 C187S possibly damaging Het
Other mutations in Tha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Tha1 APN 11 117871005 splice site probably benign
IGL01434:Tha1 APN 11 117868599 missense probably benign 0.31
IGL01658:Tha1 APN 11 117871612 missense probably damaging 1.00
R0437:Tha1 UTSW 11 117868575 missense probably benign 0.17
R0671:Tha1 UTSW 11 117873157 splice site probably benign
R1958:Tha1 UTSW 11 117869353 unclassified probably benign
R2127:Tha1 UTSW 11 117869774 missense probably damaging 0.98
R3416:Tha1 UTSW 11 117873200 missense possibly damaging 0.67
R4825:Tha1 UTSW 11 117869379 missense probably damaging 1.00
R5145:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5266:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5267:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5339:Tha1 UTSW 11 117871082 missense possibly damaging 0.87
R5858:Tha1 UTSW 11 117873384 missense unknown
R6820:Tha1 UTSW 11 117871678 missense probably benign 0.00
R7399:Tha1 UTSW 11 117869690 missense possibly damaging 0.86
R7706:Tha1 UTSW 11 117869455 missense probably damaging 1.00
R7905:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R7988:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R8322:Tha1 UTSW 11 117868667 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTGTCACTGGAGCAAACC -3'
(R):5'- GTCACCCATTTGCTCTGTGG -3'

Sequencing Primer
(F):5'- CAGAGACGGAATGATGTCACCATC -3'
(R):5'- CACCGTGGAGACCAACATGG -3'
Posted On2020-06-30