Mutagenetix > Incidental Mutations

Incidental Mutation 'R8094:Ralgapa1'

630102

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R8094 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55782846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 200 (D200V)

Ref Sequence

ENSEMBL: ENSMUSP00000082503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000085385
AA Change: D200V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: D200V

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110687
AA Change: D200V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: D200V

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219432
AA Change: D200V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220367
AA Change: D200V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226244
AA Change: D200V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	T	A	8: 12,279,824	L93H	unknown	Het
A2ml1	A	G	6: 128,572,082	Y246H	probably damaging	Het
Akap11	C	A	14: 78,512,973	C658F		Het
Akap2	A	G	4: 57,886,319	T859A	possibly damaging	Het
Arid2	T	G	15: 96,368,711	S547A	possibly damaging	Het
Atf1	C	A	15: 100,245,289	D46E	probably damaging	Het
Brca2	T	A	5: 150,536,169	F303Y	possibly damaging	Het
Btbd18	T	A	2: 84,667,916	S633T	possibly damaging	Het
Btg4	T	G	9: 51,119,145	F182V	probably benign	Het
Cacna1e	G	A	1: 154,561,770	S340F	probably damaging	Het
Camta2	A	G	11: 70,686,077	W41R	probably damaging	Het
Cbl	A	T	9: 44,163,399	D455E	probably benign	Het
Ccdc162	A	T	10: 41,612,868	D1208E	probably benign	Het
Cd177	A	T	7: 24,744,417	M752K	probably damaging	Het
Cep290	A	T	10: 100,544,931	H100L	possibly damaging	Het
Chrnb2	T	A	3: 89,761,391	I206F	probably damaging	Het
Cyp2c40	A	G	19: 39,802,565	L274S	probably benign	Het
Cyp2c40	T	A	19: 39,802,571	Y272F	probably benign	Het
Cyp2d22	C	A	15: 82,374,355	A102S	probably benign	Het
Cyp51	C	T	5: 4,086,490	E435K	probably benign	Het
Dchs2	T	C	3: 83,355,622	F3066L	probably benign	Het
Disp1	C	A	1: 183,087,628	R1076L	probably damaging	Het
Dkk2	C	T	3: 132,086,040	A3V	probably benign	Het
Dnah7b	T	C	1: 46,126,804	F543S	probably benign	Het
Dpt	A	T	1: 164,796,912	S61C	probably damaging	Het
Drg2	A	T	11: 60,462,270	Y243F	probably damaging	Het
Dsg2	A	G	18: 20,583,004		probably benign	Het
Dst	T	G	1: 34,188,959	L1878V	possibly damaging	Het
F5	A	G	1: 164,208,940	Y1890C	probably benign	Het
Fat1	T	C	8: 44,952,702	V830A	probably damaging	Het
Fat2	C	T	11: 55,296,139	D1294N	probably benign	Het
Fbxo15	A	G	18: 84,965,493	Y322C	probably benign	Het
Fhit	A	T	14: 10,751,666	N7K	unknown	Het
Fuk	A	G	8: 110,895,972	F108S	probably damaging	Het
Gabrb2	A	G	11: 42,597,543	I279V	probably damaging	Het
Galk2	T	C	2: 125,931,269	F207S	probably damaging	Het
Gm16486	T	C	8: 70,709,418	V420A	probably benign	Het
Gtpbp3	C	T	8: 71,488,836	L17F	possibly damaging	Het
Gucy2c	T	A	6: 136,737,448	D460V	probably benign	Het
Herc1	G	A	9: 66,493,180	V4329I	probably damaging	Het
Kirrel3	G	A	9: 35,035,164	V740M	probably damaging	Het
Macf1	C	A	4: 123,369,867	V6956L	probably damaging	Het
Mill1	C	T	7: 18,255,910	A39V	probably benign	Het
Mkln1	T	A	6: 31,492,653	Y599*	probably null	Het
Mrpl14	T	A	17: 45,698,113	L46Q	possibly damaging	Het
Myom2	G	T	8: 15,069,418	R103L	possibly damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ndst2	A	T	14: 20,728,164	V449D	probably damaging	Het
Nell1	T	A	7: 50,120,587	H131Q	probably benign	Het
Nos3	G	C	5: 24,367,220	R97P	probably benign	Het
Npc1	A	T	18: 12,194,240	F1099L	probably benign	Het
Nxpe5	T	A	5: 138,251,540	W531R	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1215	T	C	2: 89,002,368		probably benign	Het
Olfr1450	A	T	19: 12,954,002	T138S	probably benign	Het
Olfr3	A	T	2: 36,812,318	L258H	probably damaging	Het
Olfr800	A	G	10: 129,660,064	D86G	probably damaging	Het
Osmr	T	C	15: 6,815,621	N889S	possibly damaging	Het
Oxct2b	A	G	4: 123,116,508	I74V	possibly damaging	Het
Phldb3	C	A	7: 24,626,709	A572D	probably damaging	Het
Pigr	A	G	1: 130,846,510	E409G	probably damaging	Het
Ptprs	T	C	17: 56,428,947	E674G	probably benign	Het
Ptpru	G	A	4: 131,793,592	T801I	possibly damaging	Het
Rb1cc1	A	T	1: 6,263,224	R1429*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnpep	A	T	1: 135,283,776	L78Q	probably damaging	Het
Rtn2	A	T	7: 19,293,866	I394F	probably damaging	Het
Satb2	A	T	1: 56,831,464	V572D	possibly damaging	Het
Sds	T	C	5: 120,478,936		probably benign	Het
Serpina10	TTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCC	12: 103,628,773		probably benign	Het
Sgo2a	T	C	1: 58,017,141	I828T	possibly damaging	Het
Slc25a33	T	A	4: 149,756,152	K79N	probably benign	Het
Slc25a51	A	C	4: 45,399,783	F136V	probably benign	Het
Slfn14	T	A	11: 83,283,293	K291*	probably null	Het
Sp100	A	G	1: 85,697,098	K403E	possibly damaging	Het
Spaca1	C	T	4: 34,049,837	E54K	possibly damaging	Het
Sympk	T	G	7: 19,053,448		probably null	Het
Syne1	A	T	10: 5,117,031	V7078D	probably damaging	Het
Tas2r121	T	A	6: 132,700,809	I67L	probably benign	Het
Tha1	T	C	11: 117,868,497	K389E	probably benign	Het
Thbs2	T	A	17: 14,680,322	Q541L	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem94	T	C	11: 115,788,392		probably null	Het
Tnfsf13	A	G	11: 69,685,157	C35R	probably damaging	Het
Trcg1	C	A	9: 57,242,281	Q379K	probably benign	Het
Ubr4	T	C	4: 139,440,696	S1507P	probably damaging	Het
Uckl1	A	G	2: 181,573,256	I268T	probably damaging	Het
Uvrag	T	C	7: 98,991,967	K289E	possibly damaging	Het
Vmn2r104	C	A	17: 20,030,221	C596F	possibly damaging	Het
Vmn2r11	A	T	5: 109,053,760	F293I	probably damaging	Het
Vps13b	T	A	15: 35,668,906		probably null	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zscan4f	T	A	7: 11,401,227	C187S	possibly damaging	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGATAGCAATGGAGAGTATCTTTTC -3'
(R):5'- GGATTCACAGAACAGCCAGC -3'

Sequencing Primer
(F):5'- AGCAATGGAGAGTATCTTTTCATAAG -3'
(R):5'- GAACAGCCAGCTCTCAAGTTTATG -3'

Posted On

2020-06-30