Mutagenetix > Incidental Mutation

Incidental Mutation 'R8094:Vps13b'

630111

Institutional Source

Beutler Lab

Gene Symbol

Vps13b

Ensembl Gene

ENSMUSG00000037646

Gene Name

vacuolar protein sorting 13B

Synonyms

2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8094 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35371160-35931229 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 35668906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048646]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048646

SMART Domains

Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	120	1e-29	PFAM
low complexity region	128	137	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1007	1018	N/A	INTRINSIC
low complexity region	1876	1883	N/A	INTRINSIC
low complexity region	2042	2054	N/A	INTRINSIC
low complexity region	2414	2423	N/A	INTRINSIC
Pfam:SHR-BD	2601	2700	8.4e-10	PFAM
low complexity region	2954	2964	N/A	INTRINSIC
Pfam:VPS13_C	3539	3706	2.6e-30	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	T	A	8: 12,279,824	L93H	unknown	Het
A2ml1	A	G	6: 128,572,082	Y246H	probably damaging	Het
Akap11	C	A	14: 78,512,973	C658F		Het
Akap2	A	G	4: 57,886,319	T859A	possibly damaging	Het
Arid2	T	G	15: 96,368,711	S547A	possibly damaging	Het
Atf1	C	A	15: 100,245,289	D46E	probably damaging	Het
Brca2	T	A	5: 150,536,169	F303Y	possibly damaging	Het
Btbd18	T	A	2: 84,667,916	S633T	possibly damaging	Het
Btg4	T	G	9: 51,119,145	F182V	probably benign	Het
Cacna1e	G	A	1: 154,561,770	S340F	probably damaging	Het
Camta2	A	G	11: 70,686,077	W41R	probably damaging	Het
Cbl	A	T	9: 44,163,399	D455E	probably benign	Het
Ccdc162	A	T	10: 41,612,868	D1208E	probably benign	Het
Cd177	A	T	7: 24,744,417	M752K	probably damaging	Het
Cep290	A	T	10: 100,544,931	H100L	possibly damaging	Het
Chrnb2	T	A	3: 89,761,391	I206F	probably damaging	Het
Cyp2c40	A	G	19: 39,802,565	L274S	probably benign	Het
Cyp2c40	T	A	19: 39,802,571	Y272F	probably benign	Het
Cyp2d22	C	A	15: 82,374,355	A102S	probably benign	Het
Cyp51	C	T	5: 4,086,490	E435K	probably benign	Het
Dchs2	T	C	3: 83,355,622	F3066L	probably benign	Het
Disp1	C	A	1: 183,087,628	R1076L	probably damaging	Het
Dkk2	C	T	3: 132,086,040	A3V	probably benign	Het
Dnah7b	T	C	1: 46,126,804	F543S	probably benign	Het
Dpt	A	T	1: 164,796,912	S61C	probably damaging	Het
Drg2	A	T	11: 60,462,270	Y243F	probably damaging	Het
Dsg2	A	G	18: 20,583,004		probably benign	Het
Dst	T	G	1: 34,188,959	L1878V	possibly damaging	Het
F5	A	G	1: 164,208,940	Y1890C	probably benign	Het
Fat1	T	C	8: 44,952,702	V830A	probably damaging	Het
Fat2	C	T	11: 55,296,139	D1294N	probably benign	Het
Fbxo15	A	G	18: 84,965,493	Y322C	probably benign	Het
Fhit	A	T	14: 10,751,666	N7K	unknown	Het
Fuk	A	G	8: 110,895,972	F108S	probably damaging	Het
Gabrb2	A	G	11: 42,597,543	I279V	probably damaging	Het
Galk2	T	C	2: 125,931,269	F207S	probably damaging	Het
Gm16486	T	C	8: 70,709,418	V420A	probably benign	Het
Gtpbp3	C	T	8: 71,488,836	L17F	possibly damaging	Het
Gucy2c	T	A	6: 136,737,448	D460V	probably benign	Het
Herc1	G	A	9: 66,493,180	V4329I	probably damaging	Het
Kirrel3	G	A	9: 35,035,164	V740M	probably damaging	Het
Macf1	C	A	4: 123,369,867	V6956L	probably damaging	Het
Mill1	C	T	7: 18,255,910	A39V	probably benign	Het
Mkln1	T	A	6: 31,492,653	Y599*	probably null	Het
Mrpl14	T	A	17: 45,698,113	L46Q	possibly damaging	Het
Myom2	G	T	8: 15,069,418	R103L	possibly damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ndst2	A	T	14: 20,728,164	V449D	probably damaging	Het
Nell1	T	A	7: 50,120,587	H131Q	probably benign	Het
Nos3	G	C	5: 24,367,220	R97P	probably benign	Het
Npc1	A	T	18: 12,194,240	F1099L	probably benign	Het
Nxpe5	T	A	5: 138,251,540	W531R	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1215	T	C	2: 89,002,368		probably benign	Het
Olfr1450	A	T	19: 12,954,002	T138S	probably benign	Het
Olfr3	A	T	2: 36,812,318	L258H	probably damaging	Het
Olfr800	A	G	10: 129,660,064	D86G	probably damaging	Het
Osmr	T	C	15: 6,815,621	N889S	possibly damaging	Het
Oxct2b	A	G	4: 123,116,508	I74V	possibly damaging	Het
Phldb3	C	A	7: 24,626,709	A572D	probably damaging	Het
Pigr	A	G	1: 130,846,510	E409G	probably damaging	Het
Ptprs	T	C	17: 56,428,947	E674G	probably benign	Het
Ptpru	G	A	4: 131,793,592	T801I	possibly damaging	Het
Ralgapa1	T	A	12: 55,782,846	D200V	probably damaging	Het
Rb1cc1	A	T	1: 6,263,224	R1429*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnpep	A	T	1: 135,283,776	L78Q	probably damaging	Het
Rtn2	A	T	7: 19,293,866	I394F	probably damaging	Het
Satb2	A	T	1: 56,831,464	V572D	possibly damaging	Het
Sds	T	C	5: 120,478,936		probably benign	Het
Serpina10	TTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCC	12: 103,628,773		probably benign	Het
Sgo2a	T	C	1: 58,017,141	I828T	possibly damaging	Het
Slc25a33	T	A	4: 149,756,152	K79N	probably benign	Het
Slc25a51	A	C	4: 45,399,783	F136V	probably benign	Het
Slfn14	T	A	11: 83,283,293	K291*	probably null	Het
Sp100	A	G	1: 85,697,098	K403E	possibly damaging	Het
Spaca1	C	T	4: 34,049,837	E54K	possibly damaging	Het
Sympk	T	G	7: 19,053,448		probably null	Het
Syne1	A	T	10: 5,117,031	V7078D	probably damaging	Het
Tas2r121	T	A	6: 132,700,809	I67L	probably benign	Het
Tha1	T	C	11: 117,868,497	K389E	probably benign	Het
Thbs2	T	A	17: 14,680,322	Q541L	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem94	T	C	11: 115,788,392		probably null	Het
Tnfsf13	A	G	11: 69,685,157	C35R	probably damaging	Het
Trcg1	C	A	9: 57,242,281	Q379K	probably benign	Het
Ubr4	T	C	4: 139,440,696	S1507P	probably damaging	Het
Uckl1	A	G	2: 181,573,256	I268T	probably damaging	Het
Uvrag	T	C	7: 98,991,967	K289E	possibly damaging	Het
Vmn2r104	C	A	17: 20,030,221	C596F	possibly damaging	Het
Vmn2r11	A	T	5: 109,053,760	F293I	probably damaging	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zscan4f	T	A	7: 11,401,227	C187S	possibly damaging	Het

Other mutations in Vps13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vps13b	APN	15	35926226	missense	possibly damaging	0.52
IGL00513:Vps13b	APN	15	35793884	missense	probably damaging	1.00
IGL00516:Vps13b	APN	15	35640557	missense	probably damaging	1.00
IGL00640:Vps13b	APN	15	35417577	missense	probably benign
IGL00753:Vps13b	APN	15	35372031	missense	probably damaging	0.99
IGL00784:Vps13b	APN	15	35846900	missense	probably damaging	1.00
IGL01138:Vps13b	APN	15	35446770	splice site	probably benign
IGL01349:Vps13b	APN	15	35793945	missense	probably benign	0.00
IGL01403:Vps13b	APN	15	35709479	missense	probably benign	0.00
IGL01535:Vps13b	APN	15	35454957	missense	possibly damaging	0.67
IGL01571:Vps13b	APN	15	35877489	splice site	probably benign
IGL01642:Vps13b	APN	15	35792072	missense	probably benign	0.43
IGL01658:Vps13b	APN	15	35671333	missense	probably damaging	0.99
IGL01759:Vps13b	APN	15	35878789	missense	probably damaging	1.00
IGL01763:Vps13b	APN	15	35709799	missense	possibly damaging	0.72
IGL01906:Vps13b	APN	15	35639847	splice site	probably benign
IGL01982:Vps13b	APN	15	35438904	nonsense	probably null
IGL01997:Vps13b	APN	15	35709224	missense	probably damaging	1.00
IGL02041:Vps13b	APN	15	35423245	missense	probably damaging	0.98
IGL02073:Vps13b	APN	15	35875586	missense	possibly damaging	0.52
IGL02077:Vps13b	APN	15	35910613	missense	possibly damaging	0.68
IGL02141:Vps13b	APN	15	35572081	missense	probably benign	0.09
IGL02146:Vps13b	APN	15	35646333	missense	probably benign	0.36
IGL02197:Vps13b	APN	15	35930056	missense	probably benign	0.02
IGL02311:Vps13b	APN	15	35709514	missense	probably benign	0.08
IGL02466:Vps13b	APN	15	35770741	missense	possibly damaging	0.86
IGL02506:Vps13b	APN	15	35917162	missense	probably damaging	1.00
IGL02550:Vps13b	APN	15	35572096	missense	probably benign
IGL02553:Vps13b	APN	15	35646301	missense	probably benign	0.00
IGL02674:Vps13b	APN	15	35639958	missense	probably benign	0.41
IGL02690:Vps13b	APN	15	35917142	missense	probably damaging	1.00
IGL02731:Vps13b	APN	15	35917128	missense	probably benign	0.00
IGL02739:Vps13b	APN	15	35879900	missense	probably damaging	1.00
IGL02868:Vps13b	APN	15	35884519	missense	probably benign	0.03
IGL03081:Vps13b	APN	15	35875820	missense	probably damaging	0.97
IGL03178:Vps13b	APN	15	35869300	missense	probably damaging	1.00
IGL03343:Vps13b	APN	15	35917170	missense	possibly damaging	0.76
IGL03407:Vps13b	APN	15	35639866	missense	possibly damaging	0.95
IGL03410:Vps13b	APN	15	35910340	missense	probably benign
omlette	UTSW	15	35671400	missense	probably benign	0.13
swiss	UTSW	15	35709673	missense	possibly damaging	0.80
FR4449:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4548:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4737:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4976:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
LCD18:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
PIT4531001:Vps13b	UTSW	15	35878825	missense	probably damaging	1.00
PIT4581001:Vps13b	UTSW	15	35534263	missense	probably damaging	1.00
PIT4618001:Vps13b	UTSW	15	35709240	missense	probably damaging	1.00
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0108:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0116:Vps13b	UTSW	15	35423155	missense	probably damaging	0.99
R0123:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0124:Vps13b	UTSW	15	35576528	critical splice donor site	probably null
R0134:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0137:Vps13b	UTSW	15	35926219	missense	probably benign	0.06
R0195:Vps13b	UTSW	15	35471899	missense	probably benign	0.00
R0225:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0320:Vps13b	UTSW	15	35674828	missense	probably damaging	0.98
R0333:Vps13b	UTSW	15	35879803	missense	probably damaging	1.00
R0336:Vps13b	UTSW	15	35455133	nonsense	probably null
R0463:Vps13b	UTSW	15	35597409	missense	probably damaging	0.98
R0466:Vps13b	UTSW	15	35445602	nonsense	probably null
R0472:Vps13b	UTSW	15	35417633	critical splice donor site	probably null
R0523:Vps13b	UTSW	15	35472050	missense	probably benign	0.20
R0602:Vps13b	UTSW	15	35422368	missense	probably damaging	1.00
R0612:Vps13b	UTSW	15	35623657	missense	probably benign	0.12
R0627:Vps13b	UTSW	15	35371999	nonsense	probably null
R0679:Vps13b	UTSW	15	35709703	missense	possibly damaging	0.73
R0742:Vps13b	UTSW	15	35794361	missense	probably benign	0.22
R1053:Vps13b	UTSW	15	35652363	missense	probably damaging	1.00
R1355:Vps13b	UTSW	15	35422454	missense	probably damaging	1.00
R1386:Vps13b	UTSW	15	35923312	missense	probably damaging	0.99
R1403:Vps13b	UTSW	15	35709122	splice site	probably benign
R1453:Vps13b	UTSW	15	35422444	missense	probably damaging	0.97
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1511:Vps13b	UTSW	15	35839975	missense	probably damaging	0.99
R1511:Vps13b	UTSW	15	35841573	missense	probably benign	0.00
R1513:Vps13b	UTSW	15	35438730	nonsense	probably null
R1536:Vps13b	UTSW	15	35875566	missense	probably damaging	0.98
R1537:Vps13b	UTSW	15	35792181	missense	possibly damaging	0.62
R1558:Vps13b	UTSW	15	35534319	missense	probably damaging	1.00
R1601:Vps13b	UTSW	15	35642436	missense	probably benign	0.11
R1653:Vps13b	UTSW	15	35607272	nonsense	probably null
R1695:Vps13b	UTSW	15	35576521	missense	probably benign	0.05
R1760:Vps13b	UTSW	15	35884619	missense	possibly damaging	0.54
R1785:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1786:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1803:Vps13b	UTSW	15	35430205	nonsense	probably null
R1804:Vps13b	UTSW	15	35917137	missense	probably damaging	1.00
R1808:Vps13b	UTSW	15	35792059	missense	probably benign	0.00
R1817:Vps13b	UTSW	15	35910642	missense	possibly damaging	0.86
R1818:Vps13b	UTSW	15	35877577	missense	probably benign	0.00
R1836:Vps13b	UTSW	15	35910232	missense	probably damaging	0.99
R1850:Vps13b	UTSW	15	35674959	splice site	probably benign
R1884:Vps13b	UTSW	15	35430291	splice site	probably benign
R1938:Vps13b	UTSW	15	35709507	missense	probably damaging	1.00
R1955:Vps13b	UTSW	15	35925408	critical splice donor site	probably null
R1956:Vps13b	UTSW	15	35869407	missense	probably damaging	1.00
R1958:Vps13b	UTSW	15	35878689	missense	probably damaging	0.99
R2013:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2014:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2015:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2038:Vps13b	UTSW	15	35884741	missense	probably damaging	1.00
R2058:Vps13b	UTSW	15	35841447	missense	probably damaging	1.00
R2082:Vps13b	UTSW	15	35910746	missense	possibly damaging	0.70
R2087:Vps13b	UTSW	15	35597493	missense	probably damaging	0.99
R2124:Vps13b	UTSW	15	35646080	missense	probably benign	0.08
R2130:Vps13b	UTSW	15	35671400	missense	probably benign	0.13
R2168:Vps13b	UTSW	15	35792188	missense	probably damaging	1.00
R2168:Vps13b	UTSW	15	35792189	missense	probably damaging	1.00
R2171:Vps13b	UTSW	15	35887197	missense	probably benign	0.44
R2221:Vps13b	UTSW	15	35884597	missense	probably benign
R2263:Vps13b	UTSW	15	35646181	missense	probably benign	0.02
R2289:Vps13b	UTSW	15	35572105	missense	probably damaging	1.00
R2316:Vps13b	UTSW	15	35674899	nonsense	probably null
R2351:Vps13b	UTSW	15	35869311	missense	probably damaging	1.00
R2512:Vps13b	UTSW	15	35884555	missense	probably benign	0.35
R3054:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3055:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3196:Vps13b	UTSW	15	35869395	missense	probably damaging	1.00
R3236:Vps13b	UTSW	15	35910304	missense	probably benign	0.40
R3404:Vps13b	UTSW	15	35926054	missense	probably damaging	1.00
R3722:Vps13b	UTSW	15	35671382	missense	probably damaging	0.99
R4077:Vps13b	UTSW	15	35455128	missense	probably damaging	0.99
R4153:Vps13b	UTSW	15	35792027	splice site	probably null
R4224:Vps13b	UTSW	15	35876419	missense	probably damaging	0.99
R4408:Vps13b	UTSW	15	35709294	missense	probably damaging	0.98
R4431:Vps13b	UTSW	15	35770753	missense	probably damaging	1.00
R4449:Vps13b	UTSW	15	35876793	missense	possibly damaging	0.86
R4508:Vps13b	UTSW	15	35709673	missense	possibly damaging	0.80
R4631:Vps13b	UTSW	15	35646132	missense	possibly damaging	0.95
R4655:Vps13b	UTSW	15	35770689	missense	probably benign
R4666:Vps13b	UTSW	15	35640544	missense	probably benign	0.13
R4684:Vps13b	UTSW	15	35646178	missense	probably damaging	0.98
R4684:Vps13b	UTSW	15	35841341	missense	probably benign
R4684:Vps13b	UTSW	15	35879821	missense	probably benign
R4721:Vps13b	UTSW	15	35910718	nonsense	probably null
R4771:Vps13b	UTSW	15	35910800	missense	probably damaging	1.00
R4830:Vps13b	UTSW	15	35452224	missense	possibly damaging	0.94
R4835:Vps13b	UTSW	15	35869372	missense	probably damaging	1.00
R4835:Vps13b	UTSW	15	35910293	missense	probably benign
R4857:Vps13b	UTSW	15	35456654	missense	probably benign	0.01
R4891:Vps13b	UTSW	15	35640515	splice site	probably null
R5095:Vps13b	UTSW	15	35923202	missense	probably damaging	1.00
R5110:Vps13b	UTSW	15	35770809	missense	probably damaging	0.99
R5147:Vps13b	UTSW	15	35456678	missense	probably benign	0.32
R5153:Vps13b	UTSW	15	35422453	missense	probably damaging	0.99
R5257:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5258:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5296:Vps13b	UTSW	15	35876413	missense	probably damaging	1.00
R5386:Vps13b	UTSW	15	35640528	critical splice acceptor site	probably null
R5396:Vps13b	UTSW	15	35886948	missense	probably damaging	0.99
R5412:Vps13b	UTSW	15	35533385	missense	probably damaging	1.00
R5488:Vps13b	UTSW	15	35770542	missense	probably benign
R5489:Vps13b	UTSW	15	35770542	missense	probably benign
R5503:Vps13b	UTSW	15	35452166	missense	probably damaging	0.97
R5575:Vps13b	UTSW	15	35929919	missense	probably damaging	1.00
R5781:Vps13b	UTSW	15	35794035	missense	probably damaging	0.97
R5872:Vps13b	UTSW	15	35869351	missense	possibly damaging	0.56
R5876:Vps13b	UTSW	15	35917061	missense	probably damaging	0.99
R5994:Vps13b	UTSW	15	35875772	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6045:Vps13b	UTSW	15	35671316	missense	probably damaging	0.99
R6143:Vps13b	UTSW	15	35668738	missense	probably damaging	0.99
R6147:Vps13b	UTSW	15	35930031	missense	probably benign	0.16
R6218:Vps13b	UTSW	15	35770464	missense	probably benign	0.00
R6447:Vps13b	UTSW	15	35572126	missense	probably benign	0.02
R6555:Vps13b	UTSW	15	35846847	missense	probably damaging	1.00
R6578:Vps13b	UTSW	15	35446101	missense	probably damaging	0.99
R6640:Vps13b	UTSW	15	35617696	missense	possibly damaging	0.93
R6645:Vps13b	UTSW	15	35910305	missense	probably benign	0.25
R6711:Vps13b	UTSW	15	35887249	missense	probably damaging	1.00
R6727:Vps13b	UTSW	15	35770683	missense	probably benign	0.19
R6737:Vps13b	UTSW	15	35910611	missense	probably damaging	1.00
R6844:Vps13b	UTSW	15	35877590	missense	probably benign	0.06
R6849:Vps13b	UTSW	15	35905309	missense	probably damaging	1.00
R6861:Vps13b	UTSW	15	35576395	missense	probably damaging	0.99
R6938:Vps13b	UTSW	15	35423198	missense	probably damaging	0.99
R6943:Vps13b	UTSW	15	35448689	missense	possibly damaging	0.95
R6989:Vps13b	UTSW	15	35448581	missense	probably benign	0.02
R7092:Vps13b	UTSW	15	35640634	missense	probably damaging	1.00
R7232:Vps13b	UTSW	15	35877557	missense	probably damaging	1.00
R7307:Vps13b	UTSW	15	35841545	missense	probably benign
R7400:Vps13b	UTSW	15	35378900	missense	probably damaging	1.00
R7414:Vps13b	UTSW	15	35910827	missense	probably damaging	1.00
R7497:Vps13b	UTSW	15	35876697	missense	probably benign	0.38
R7500:Vps13b	UTSW	15	35910524	missense	possibly damaging	0.74
R7603:Vps13b	UTSW	15	35576439	missense	probably damaging	0.98
R7605:Vps13b	UTSW	15	35770646	missense	probably damaging	0.97
R7849:Vps13b	UTSW	15	35423232	missense	probably damaging	0.99
R7984:Vps13b	UTSW	15	35879913	missense	probably benign
R8097:Vps13b	UTSW	15	35709346	missense	probably benign	0.38
R8131:Vps13b	UTSW	15	35372109	critical splice donor site	probably null
R8139:Vps13b	UTSW	15	35607272	nonsense	probably null
R8174:Vps13b	UTSW	15	35709310	nonsense	probably null
R8225:Vps13b	UTSW	15	35794382	missense	probably damaging	0.99
R8239:Vps13b	UTSW	15	35597404	missense	probably damaging	1.00
R8244:Vps13b	UTSW	15	35917203	missense	probably damaging	1.00
R8303:Vps13b	UTSW	15	35639917	missense	probably damaging	1.00
R8311:Vps13b	UTSW	15	35886954	missense	probably benign	0.37
R8443:Vps13b	UTSW	15	35455100	missense	probably benign
R8494:Vps13b	UTSW	15	35422448	missense	probably damaging	0.99
R8499:Vps13b	UTSW	15	35841320	missense	probably damaging	1.00
R8506:Vps13b	UTSW	15	35446745	missense	probably benign	0.31
R8559:Vps13b	UTSW	15	35876642	missense	probably damaging	1.00
R8686:Vps13b	UTSW	15	35925389	missense	probably damaging	0.99
R8782:Vps13b	UTSW	15	35422337	missense	possibly damaging	0.93
R8806:Vps13b	UTSW	15	35472066	critical splice donor site	probably benign
R8824:Vps13b	UTSW	15	35533299	missense	probably damaging	0.99
R9024:Vps13b	UTSW	15	35923324	missense	probably damaging	0.97
R9038:Vps13b	UTSW	15	35875785	missense	possibly damaging	0.70
R9054:Vps13b	UTSW	15	35422391	missense	probably damaging	1.00
R9091:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9129:Vps13b	UTSW	15	35448647	missense	probably damaging	1.00
R9214:Vps13b	UTSW	15	35623746	missense	probably damaging	0.99
R9237:Vps13b	UTSW	15	35841333	missense	probably damaging	1.00
R9256:Vps13b	UTSW	15	35623779	missense	possibly damaging	0.95
R9270:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9279:Vps13b	UTSW	15	35572144	missense	probably damaging	0.97
R9291:Vps13b	UTSW	15	35846913	missense	probably damaging	1.00
R9342:Vps13b	UTSW	15	35455054	missense	possibly damaging	0.94
R9404:Vps13b	UTSW	15	35876419	missense	probably damaging	1.00
R9488:Vps13b	UTSW	15	35447734	missense	possibly damaging	0.77
R9509:Vps13b	UTSW	15	35841311	missense	possibly damaging	0.79
R9610:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9611:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9658:Vps13b	UTSW	15	35623628	missense	probably benign	0.00
R9674:Vps13b	UTSW	15	35607234	missense	probably damaging	0.98
R9696:Vps13b	UTSW	15	35674887	missense	possibly damaging	0.56
R9767:Vps13b	UTSW	15	35910257	missense	probably damaging	1.00
R9797:Vps13b	UTSW	15	35674876	missense	probably damaging	1.00
RF020:Vps13b	UTSW	15	35925406	missense	probably null	1.00
X0026:Vps13b	UTSW	15	35910646	missense	probably damaging	1.00
X0028:Vps13b	UTSW	15	35709431	missense	probably benign	0.00
Z1177:Vps13b	UTSW	15	35668885	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCAGGAAAGCCTTAAACTTAGG -3'
(R):5'- TCTTGGACGACCAGGAATAAC -3'

Sequencing Primer
(F):5'- AGGAATTCTTCGAGATCCTGGATCAG -3'
(R):5'- TCTTGGACGACCAGGAATAACCATTG -3'

Posted On

2020-06-30