Incidental Mutation 'R8095:Slc9a8'
ID630131
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167468971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 384 (V384D)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably damaging
Transcript: ENSMUST00000047815
AA Change: V384D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: V384D

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073873
AA Change: V357D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: V357D

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109218
AA Change: V353D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: V353D

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8725:Slc9a8 UTSW 2 167473534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTGCTAGTGAGTGATGC -3'
(R):5'- CCAGCTCACATGGAAATACTTC -3'

Sequencing Primer
(F):5'- AGTGATGCTTGCTAGTCTCTTC -3'
(R):5'- CTCGGAAGAAGTTCAGCA -3'
Posted On2020-06-30