Incidental Mutation 'R8095:Snx16'
ID630133
Institutional Source Beutler Lab
Gene Symbol Snx16
Ensembl Gene ENSMUSG00000027534
Gene Namesorting nexin 16
Synonyms4930522N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location10417817-10440102 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 10438184 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000029047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029047] [ENSMUST00000099223] [ENSMUST00000195822]
Predicted Effect probably null
Transcript: ENSMUST00000029047
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029047
Gene: ENSMUSG00000027534
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099223
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096828
Gene: ENSMUSG00000027534
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195822
AA Change: M1K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141230
Gene: ENSMUSG00000027534
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Blast:PX 105 134 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The protein encoded by this gene associates with late endosome membranes as is involved in tubule formation, cholesterol transport, and transport of tetraspanin CD81. The encoded protein also inhibits cell migration and tumorigenesis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Snx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Snx16 APN 3 10419159 missense probably damaging 1.00
IGL02682:Snx16 APN 3 10438175 missense probably damaging 1.00
R0539:Snx16 UTSW 3 10426218 missense probably damaging 0.98
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1771:Snx16 UTSW 3 10419161 missense probably damaging 1.00
R5262:Snx16 UTSW 3 10437832 missense probably damaging 1.00
R5693:Snx16 UTSW 3 10420258 missense probably benign 0.00
R5964:Snx16 UTSW 3 10434481 missense possibly damaging 0.92
R5969:Snx16 UTSW 3 10438157 missense possibly damaging 0.93
R6826:Snx16 UTSW 3 10438088 missense probably damaging 0.99
R7456:Snx16 UTSW 3 10435481 nonsense probably null
R7996:Snx16 UTSW 3 10435449 missense probably benign 0.11
R8880:Snx16 UTSW 3 10419133 missense probably benign 0.01
Z1177:Snx16 UTSW 3 10420858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATCCTGGACATTCGTCTGC -3'
(R):5'- TGATGTTACCCATGTCTTCATAGG -3'

Sequencing Primer
(F):5'- GATCCTGGACATTCGTCTGCTTAAG -3'
(R):5'- CCCATGTCTTCATAGGTAATTGAGTG -3'
Posted On2020-06-30