Incidental Mutation 'R8095:Olfr536'
ID630148
Institutional Source Beutler Lab
Gene Symbol Olfr536
Ensembl Gene ENSMUSG00000052508
Gene Nameolfactory receptor 536
SynonymsGA_x6K02T2PBJ9-42653501-42652578, MOR252-1, MOR252-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140500849-140507396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140504279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000067699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064392] [ENSMUST00000209873] [ENSMUST00000215340] [ENSMUST00000215768]
Predicted Effect probably damaging
Transcript: ENSMUST00000064392
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067699
Gene: ENSMUSG00000052508
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 8.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 5.4e-6 PFAM
Pfam:7tm_1 41 289 3.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209873
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215340
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215768
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Olfr536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr536 APN 7 140504184 missense probably damaging 1.00
IGL02065:Olfr536 APN 7 140504164 missense probably benign 0.02
IGL02812:Olfr536 APN 7 140503620 missense probably damaging 0.99
IGL02896:Olfr536 APN 7 140504055 splice site probably null
IGL03281:Olfr536 APN 7 140503800 missense probably damaging 1.00
R2440:Olfr536 UTSW 7 140503552 missense probably benign 0.25
R3110:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R3112:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R4349:Olfr536 UTSW 7 140504357 nonsense probably null
R4660:Olfr536 UTSW 7 140504020 missense probably benign 0.03
R4827:Olfr536 UTSW 7 140503670 missense probably damaging 0.96
R5606:Olfr536 UTSW 7 140503800 missense probably damaging 1.00
R5607:Olfr536 UTSW 7 140504405 missense probably benign 0.10
R7102:Olfr536 UTSW 7 140504316 missense probably benign 0.05
R7354:Olfr536 UTSW 7 140504186 missense probably damaging 1.00
R8081:Olfr536 UTSW 7 140504456 start codon destroyed probably null 1.00
R8520:Olfr536 UTSW 7 140504402 missense probably benign 0.14
Z1088:Olfr536 UTSW 7 140503805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAGGTAGCGGTCATAGG -3'
(R):5'- TTCCTGTCCTGAGACTAGAGG -3'

Sequencing Primer
(F):5'- TAGCGGTCATAGGCCATGG -3'
(R):5'- AGACTAGAGGTGCTTCCCATG -3'
Posted On2020-06-30