Incidental Mutation 'R8095:Vrtn'
ID630160
Institutional Source Beutler Lab
Gene Symbol Vrtn
Ensembl Gene ENSMUSG00000071235
Gene Namevertebrae development associated
Synonyms7420416P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84641019-84651455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84650035 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 520 (R520C)
Ref Sequence ENSEMBL: ENSMUSP00000093207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095551] [ENSMUST00000166772] [ENSMUST00000167227] [ENSMUST00000221915] [ENSMUST00000222319]
Predicted Effect probably damaging
Transcript: ENSMUST00000095551
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093207
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000166772
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128808
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000167227
AA Change: R520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132050
Gene: ENSMUSG00000071235
AA Change: R520C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000221915
Predicted Effect probably benign
Transcript: ENSMUST00000222319
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Vrtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Vrtn APN 12 84649063 missense probably benign 0.01
IGL01777:Vrtn APN 12 84648922 missense probably benign 0.13
IGL01911:Vrtn APN 12 84650206 missense probably benign
IGL02219:Vrtn APN 12 84648833 missense probably damaging 1.00
IGL02684:Vrtn APN 12 84650149 missense probably benign
IGL02947:Vrtn APN 12 84648484 missense probably damaging 0.98
IGL03296:Vrtn APN 12 84648848 missense probably damaging 1.00
PIT4378001:Vrtn UTSW 12 84649169 missense probably damaging 0.99
R0044:Vrtn UTSW 12 84648605 missense probably damaging 1.00
R1546:Vrtn UTSW 12 84648508 missense probably damaging 1.00
R1584:Vrtn UTSW 12 84650081 missense probably damaging 1.00
R1693:Vrtn UTSW 12 84648655 missense probably benign 0.03
R1773:Vrtn UTSW 12 84650224 missense probably damaging 0.98
R1951:Vrtn UTSW 12 84649199 missense probably damaging 1.00
R2143:Vrtn UTSW 12 84650162 missense probably benign 0.00
R4044:Vrtn UTSW 12 84649070 missense probably damaging 1.00
R4777:Vrtn UTSW 12 84648826 missense probably damaging 1.00
R4835:Vrtn UTSW 12 84649694 missense probably damaging 0.97
R5076:Vrtn UTSW 12 84649474 missense probably damaging 1.00
R5783:Vrtn UTSW 12 84650477 missense probably benign 0.31
R5831:Vrtn UTSW 12 84648575 missense probably damaging 1.00
R6349:Vrtn UTSW 12 84649018 missense probably damaging 1.00
R6499:Vrtn UTSW 12 84650316 missense probably benign 0.01
R6931:Vrtn UTSW 12 84650242 missense probably benign
R7192:Vrtn UTSW 12 84648862 missense probably damaging 0.98
R7789:Vrtn UTSW 12 84650306 missense probably benign
R8059:Vrtn UTSW 12 84649916 missense probably benign
R8096:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8136:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8142:Vrtn UTSW 12 84650621 missense probably damaging 1.00
R8557:Vrtn UTSW 12 84649916 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTGCTGAGTCTCTCCAGC -3'
(R):5'- CCTGTGGTTCAACTGGCTTCTG -3'

Sequencing Primer
(F):5'- TGAGTCTCTCCAGCCAACAGATG -3'
(R):5'- GGGCTTCTGCTGTTCCTCG -3'
Posted On2020-06-30