Incidental Mutation 'R8095:Fam98a'
ID630170
Institutional Source Beutler Lab
Gene Symbol Fam98a
Ensembl Gene ENSMUSG00000002017
Gene Namefamily with sequence similarity 98, member A
Synonyms2810405J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location75537086-75551946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75538771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 327 (D327Y)
Ref Sequence ENSEMBL: ENSMUSP00000108126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112507]
Predicted Effect probably damaging
Transcript: ENSMUST00000112507
AA Change: D327Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108126
Gene: ENSMUSG00000002017
AA Change: D327Y

DomainStartEndE-ValueType
Pfam:DUF2465 11 328 1.1e-137 PFAM
low complexity region 334 396 N/A INTRINSIC
low complexity region 401 441 N/A INTRINSIC
low complexity region 448 481 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
Meta Mutation Damage Score 0.3017 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Fam98a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Fam98a APN 17 75551747 missense probably damaging 1.00
IGL00548:Fam98a APN 17 75538818 missense probably damaging 1.00
IGL02170:Fam98a APN 17 75540192 critical splice acceptor site probably null
IGL02399:Fam98a APN 17 75538941 splice site probably benign
IGL03062:Fam98a APN 17 75540105 splice site probably benign
IGL03246:Fam98a APN 17 75538853 missense probably damaging 0.99
R0584:Fam98a UTSW 17 75544777 missense probably damaging 1.00
R0594:Fam98a UTSW 17 75538487 nonsense probably null
R1121:Fam98a UTSW 17 75538534 missense unknown
R1366:Fam98a UTSW 17 75539386 splice site probably benign
R1387:Fam98a UTSW 17 75538269 missense unknown
R1424:Fam98a UTSW 17 75540178 missense probably damaging 1.00
R1533:Fam98a UTSW 17 75541281 missense probably damaging 1.00
R1651:Fam98a UTSW 17 75547715 missense probably benign 0.16
R2211:Fam98a UTSW 17 75538945 critical splice donor site probably null
R4295:Fam98a UTSW 17 75541347 missense probably damaging 1.00
R4350:Fam98a UTSW 17 75541225 missense probably damaging 1.00
R4963:Fam98a UTSW 17 75538982 missense probably damaging 0.99
R5320:Fam98a UTSW 17 75538815 missense probably damaging 1.00
R5383:Fam98a UTSW 17 75538581 missense unknown
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R7058:Fam98a UTSW 17 75538389 missense unknown
R7182:Fam98a UTSW 17 75539018 nonsense probably null
R7505:Fam98a UTSW 17 75538238 missense unknown
R7554:Fam98a UTSW 17 75547675 nonsense probably null
R7566:Fam98a UTSW 17 75547662 missense probably damaging 1.00
R8467:Fam98a UTSW 17 75544835 missense probably damaging 1.00
R8790:Fam98a UTSW 17 75547689 missense possibly damaging 0.93
R8827:Fam98a UTSW 17 75544829 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCTCGATAAGCACCGTCCTG -3'
(R):5'- GCCTGTGCCATTAATAAGGTGAC -3'

Sequencing Primer
(F):5'- TCTCGATAAGCACCGTCCTGATAAC -3'
(R):5'- CTGTGCCATTAATAAGGTGACTAGAG -3'
Posted On2020-06-30