Incidental Mutation 'R8096:Srrm3'
ID630189
Institutional Source Beutler Lab
Gene Symbol Srrm3
Ensembl Gene ENSMUSG00000039860
Gene Nameserine/arginine repetitive matrix 3
Synonyms2900083I11Rik, Srrm2l, SRm300-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R8096 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135806890-135874772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135869240 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 555 (I555N)
Ref Sequence ENSEMBL: ENSMUSP00000115695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013615] [ENSMUST00000144211]
Predicted Effect probably benign
Transcript: ENSMUST00000013615
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144211
AA Change: I555N
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860
AA Change: I555N

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G A 14: 54,645,269 A999V possibly damaging Het
Actn4 A G 7: 28,894,583 I833T possibly damaging Het
Actn4 C A 7: 28,901,913 R470L probably damaging Het
Adgre4 T A 17: 55,820,700 I580N probably damaging Het
Arid5b T A 10: 68,186,152 T203S probably benign Het
Astn1 A G 1: 158,609,320 Y824C probably damaging Het
Cacna2d3 A G 14: 29,103,700 V506A possibly damaging Het
Cdk17 T G 10: 93,216,367 M103R probably damaging Het
Clca3a1 T A 3: 144,749,685 E449V probably damaging Het
Cux2 A G 5: 121,869,097 Y834H possibly damaging Het
Dynlrb2 A G 8: 116,507,517 T7A possibly damaging Het
Ggcx G A 6: 72,429,993 R704Q probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr87 A T 3: 59,179,808 L92Q possibly damaging Het
Grik1 C T 16: 88,006,467 G279E Het
Igsf10 G T 3: 59,328,959 T1267N probably damaging Het
Mrc2 G T 11: 105,343,507 R951L probably damaging Het
Muc4 T A 16: 32,755,390 S1755T unknown Het
Muc5b T C 7: 141,849,555 V751A unknown Het
Olfr1044 T A 2: 86,171,712 Y35F probably damaging Het
Olfr365 T A 2: 37,202,066 V275E probably damaging Het
Olfr518 A T 7: 108,881,041 C188* probably null Het
Pclo A G 5: 14,712,961 Y531C Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Rsph14 T A 10: 74,959,661 I231F possibly damaging Het
Ryr1 A G 7: 29,009,201 S4812P unknown Het
Scgb2b24 T A 7: 33,739,221 probably null Het
Scn2a T A 2: 65,764,022 H1738Q probably damaging Het
Scrib A T 15: 76,062,709 D678E probably benign Het
Slc39a8 T C 3: 135,884,656 F370S probably damaging Het
Sphkap A T 1: 83,277,558 D823E probably damaging Het
Stx19 A C 16: 62,822,161 E113D possibly damaging Het
Tex30 A T 1: 44,088,503 Y91N probably damaging Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Tnik G A 3: 28,661,778 M1180I possibly damaging Het
Tnn C T 1: 160,122,841 A732T probably damaging Het
Tpra1 C T 6: 88,911,717 Q294* probably null Het
Trim24 G T 6: 37,958,657 S895I probably benign Het
Trim68 A G 7: 102,678,442 S435P probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Zfp280d T C 9: 72,319,278 C335R probably damaging Het
Zfp958 G T 8: 4,613,273 probably benign Het
Other mutations in Srrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Srrm3 APN 5 135835249 missense probably damaging 1.00
IGL02716:Srrm3 APN 5 135854433 splice site probably null
IGL03099:Srrm3 APN 5 135869298 splice site probably benign
P0047:Srrm3 UTSW 5 135852926 splice site probably null
R0688:Srrm3 UTSW 5 135869276 utr 3 prime probably benign
R0811:Srrm3 UTSW 5 135873282 unclassified probably benign
R0812:Srrm3 UTSW 5 135873282 unclassified probably benign
R1083:Srrm3 UTSW 5 135854409 missense probably damaging 0.99
R1161:Srrm3 UTSW 5 135854392 small deletion probably benign
R1656:Srrm3 UTSW 5 135835038 critical splice acceptor site probably null
R1694:Srrm3 UTSW 5 135873225 unclassified probably benign
R1803:Srrm3 UTSW 5 135857129 missense probably damaging 0.99
R2037:Srrm3 UTSW 5 135854377 missense probably damaging 1.00
R2436:Srrm3 UTSW 5 135835176 nonsense probably null
R3826:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R3829:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R4840:Srrm3 UTSW 5 135854595 missense possibly damaging 0.81
R6526:Srrm3 UTSW 5 135835234 missense probably damaging 1.00
R6843:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R7408:Srrm3 UTSW 5 135852206 missense probably benign 0.04
R7583:Srrm3 UTSW 5 135852281 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCAACCGGAATAGTGTGG -3'
(R):5'- ATGACCCCTGAGTCCACTAG -3'

Sequencing Primer
(F):5'- CCGGAATAGTGTGGTGGGAG -3'
(R):5'- TTCCTCAGTATTAGAATCAGACCAC -3'
Posted On2020-06-30