Incidental Mutation 'R8096:Cdk17'
ID630205
Institutional Source Beutler Lab
Gene Symbol Cdk17
Ensembl Gene ENSMUSG00000020015
Gene Namecyclin-dependent kinase 17
SynonymsPctk2, 6430598J10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R8096 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93160875-93267071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 93216367 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 103 (M103R)
Ref Sequence ENSEMBL: ENSMUSP00000070355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069965] [ENSMUST00000213378] [ENSMUST00000215286]
Predicted Effect probably damaging
Transcript: ENSMUST00000069965
AA Change: M103R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070355
Gene: ENSMUSG00000020015
AA Change: M103R

DomainStartEndE-ValueType
S_TKc 192 473 4.67e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213378
Predicted Effect probably damaging
Transcript: ENSMUST00000215286
AA Change: M70R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G A 14: 54,645,269 A999V possibly damaging Het
Actn4 A G 7: 28,894,583 I833T possibly damaging Het
Actn4 C A 7: 28,901,913 R470L probably damaging Het
Adgre4 T A 17: 55,820,700 I580N probably damaging Het
Arid5b T A 10: 68,186,152 T203S probably benign Het
Astn1 A G 1: 158,609,320 Y824C probably damaging Het
Cacna2d3 A G 14: 29,103,700 V506A possibly damaging Het
Clca3a1 T A 3: 144,749,685 E449V probably damaging Het
Cux2 A G 5: 121,869,097 Y834H possibly damaging Het
Dynlrb2 A G 8: 116,507,517 T7A possibly damaging Het
Ggcx G A 6: 72,429,993 R704Q probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr87 A T 3: 59,179,808 L92Q possibly damaging Het
Grik1 C T 16: 88,006,467 G279E Het
Igsf10 G T 3: 59,328,959 T1267N probably damaging Het
Mrc2 G T 11: 105,343,507 R951L probably damaging Het
Muc4 T A 16: 32,755,390 S1755T unknown Het
Muc5b T C 7: 141,849,555 V751A unknown Het
Olfr1044 T A 2: 86,171,712 Y35F probably damaging Het
Olfr365 T A 2: 37,202,066 V275E probably damaging Het
Olfr518 A T 7: 108,881,041 C188* probably null Het
Pclo A G 5: 14,712,961 Y531C Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Rsph14 T A 10: 74,959,661 I231F possibly damaging Het
Ryr1 A G 7: 29,009,201 S4812P unknown Het
Scgb2b24 T A 7: 33,739,221 probably null Het
Scn2a T A 2: 65,764,022 H1738Q probably damaging Het
Scrib A T 15: 76,062,709 D678E probably benign Het
Slc39a8 T C 3: 135,884,656 F370S probably damaging Het
Sphkap A T 1: 83,277,558 D823E probably damaging Het
Srrm3 T A 5: 135,869,240 I555N unknown Het
Stx19 A C 16: 62,822,161 E113D possibly damaging Het
Tex30 A T 1: 44,088,503 Y91N probably damaging Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Tnik G A 3: 28,661,778 M1180I possibly damaging Het
Tnn C T 1: 160,122,841 A732T probably damaging Het
Tpra1 C T 6: 88,911,717 Q294* probably null Het
Trim24 G T 6: 37,958,657 S895I probably benign Het
Trim68 A G 7: 102,678,442 S435P probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Zfp280d T C 9: 72,319,278 C335R probably damaging Het
Zfp958 G T 8: 4,613,273 probably benign Het
Other mutations in Cdk17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cdk17 APN 10 93226771 missense probably damaging 1.00
IGL00781:Cdk17 APN 10 93232416 missense probably damaging 1.00
IGL01622:Cdk17 APN 10 93238962 unclassified probably benign
IGL01623:Cdk17 APN 10 93238962 unclassified probably benign
IGL01732:Cdk17 APN 10 93218045 missense probably benign 0.01
IGL01768:Cdk17 APN 10 93208261 missense probably damaging 0.99
IGL02942:Cdk17 APN 10 93238968 missense probably benign
IGL03308:Cdk17 APN 10 93221644 critical splice donor site probably null
R0039:Cdk17 UTSW 10 93226778 splice site probably benign
R0398:Cdk17 UTSW 10 93237840 missense probably benign 0.01
R0432:Cdk17 UTSW 10 93237790 unclassified probably benign
R0609:Cdk17 UTSW 10 93216472 missense probably benign
R0781:Cdk17 UTSW 10 93239033 nonsense probably null
R1110:Cdk17 UTSW 10 93239033 nonsense probably null
R1604:Cdk17 UTSW 10 93232498 missense probably damaging 1.00
R1674:Cdk17 UTSW 10 93221630 missense probably benign 0.21
R1758:Cdk17 UTSW 10 93208250 missense probably damaging 1.00
R1797:Cdk17 UTSW 10 93208252 missense possibly damaging 0.76
R1864:Cdk17 UTSW 10 93226105 missense probably damaging 1.00
R1924:Cdk17 UTSW 10 93226117 missense probably damaging 1.00
R1929:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R2143:Cdk17 UTSW 10 93218019 missense probably damaging 1.00
R2207:Cdk17 UTSW 10 93228762 missense probably damaging 1.00
R2261:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R2262:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R3737:Cdk17 UTSW 10 93221644 critical splice donor site probably null
R3883:Cdk17 UTSW 10 93212077 critical splice donor site probably null
R4436:Cdk17 UTSW 10 93211896 splice site probably null
R5372:Cdk17 UTSW 10 93226039 missense probably benign 0.03
R5444:Cdk17 UTSW 10 93217961 splice site probably null
R5488:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5489:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5815:Cdk17 UTSW 10 93228697 missense probably damaging 1.00
R6164:Cdk17 UTSW 10 93235469 missense probably benign 0.26
R6209:Cdk17 UTSW 10 93208231 missense probably benign 0.05
R6384:Cdk17 UTSW 10 93211965 missense probably damaging 0.99
R6627:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R6698:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R7164:Cdk17 UTSW 10 93232481 missense probably benign 0.07
R8118:Cdk17 UTSW 10 93216390 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCTGTGGATCTCGAGCATAG -3'
(R):5'- GCAAAGAAACAGCTCTTGTGTG -3'

Sequencing Primer
(F):5'- GGATCTCGAGCATAGACGACTTTC -3'
(R):5'- AGAAACAGCTCTTGTGTGAGTTCC -3'
Posted On2020-06-30