Incidental Mutation 'R8097:Cps1'
ID630216
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8097 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67228270 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1399 (N1399S)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably benign
Transcript: ENSMUST00000027144
AA Change: N1399S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: N1399S

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,816,955 M749I probably benign Het
Adcy8 A T 15: 64,871,862 probably null Het
Adgrb2 G A 4: 130,007,897 C438Y probably damaging Het
Amn1 G A 6: 149,169,355 probably benign Het
Atxn2 C T 5: 121,749,223 R319W probably damaging Het
Ccdc162 T C 10: 41,634,119 E830G probably benign Het
Ccdc71 T C 9: 108,463,552 V188A probably benign Het
Ceacam11 A T 7: 17,975,530 R218* probably null Het
Col18a1 A C 10: 77,112,508 L390R unknown Het
Ctnnal1 T C 4: 56,847,845 E98G probably damaging Het
Cyp1a2 T A 9: 57,679,553 probably null Het
Cyp2d11 C A 15: 82,390,380 probably null Het
Cyp2j7 G A 4: 96,215,410 T296I possibly damaging Het
Dcc C T 18: 71,679,502 G407D probably damaging Het
E330034G19Rik T C 14: 24,306,852 L217S unknown Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 A G 10: 96,026,654 K813E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etf1 T C 18: 34,931,644 D4G probably benign Het
F830045P16Rik T C 2: 129,463,585 T290A possibly damaging Het
Filip1 T C 9: 79,818,259 D1026G probably benign Het
Flad1 A T 3: 89,409,135 L40H probably damaging Het
Fpr3 C A 17: 17,970,792 N108K probably damaging Het
Galntl6 A G 8: 57,962,373 probably null Het
Gm30302 T A 13: 49,790,200 M1L probably benign Het
Hmgcll1 T C 9: 76,015,139 L22P probably benign Het
Iars2 C T 1: 185,329,389 probably benign Het
Ifna15 A T 4: 88,557,701 L182Q probably benign Het
Kcna6 A T 6: 126,738,612 V438E probably damaging Het
Kcnma1 T A 14: 23,330,964 D1012V probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 G A 10: 27,190,664 Q1074* probably null Het
Lhx9 T C 1: 138,838,351 Y242C probably damaging Het
Lrrc37a T A 11: 103,504,099 I167F probably benign Het
Lrrc49 T A 9: 60,615,048 T351S probably benign Het
Lrrc56 A G 7: 141,195,906 probably null Het
Mlh1 C A 9: 111,256,092 probably null Het
Msh4 C T 3: 153,877,908 probably null Het
Nav2 A G 7: 49,587,777 D1999G probably damaging Het
Ncapd2 A T 6: 125,168,982 I1272K possibly damaging Het
Neurl1a A G 19: 47,257,519 D530G probably damaging Het
Nid2 T C 14: 19,798,589 V1019A possibly damaging Het
Nlrp2 A T 7: 5,327,651 L582Q probably damaging Het
Olfr1046 A T 2: 86,217,666 F15I probably damaging Het
Olfr1226 A T 2: 89,193,632 I134N probably damaging Het
Olfr33 A G 7: 102,713,990 V141A possibly damaging Het
Olfr99 A T 17: 37,279,927 Y164* probably null Het
Pde6c G T 19: 38,161,966 E520* probably null Het
Pdzk1 C T 3: 96,850,240 T4I probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rap1gap G T 4: 137,728,286 V667F probably benign Het
Recql A T 6: 142,374,911 I137N probably damaging Het
Ryr2 T C 13: 11,945,995 E19G probably damaging Het
Ryr3 T C 2: 112,670,270 probably null Het
Six1 A G 12: 73,043,750 S214P possibly damaging Het
Slc24a1 T C 9: 64,924,452 D1121G probably damaging Het
Slc30a6 T A 17: 74,412,698 C218S possibly damaging Het
Stab2 T C 10: 86,869,095 D1803G possibly damaging Het
Sult2a3 A T 7: 14,082,710 V181E possibly damaging Het
Ubc C T 5: 125,389,918 probably benign Het
Usp8 A G 2: 126,754,880 N870S probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vps13b T C 15: 35,709,346 I1813T probably benign Het
Wdr11 C T 7: 129,607,887 P473L probably damaging Het
Zcchc4 T A 5: 52,795,991 I114N probably benign Het
Zfp516 C A 18: 82,987,170 S733* probably null Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R8357:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8435:Cps1 UTSW 1 67212430 missense probably benign 0.07
R8457:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8680:Cps1 UTSW 1 67204613 missense probably damaging 1.00
R8805:Cps1 UTSW 1 67176951 missense probably damaging 1.00
R8811:Cps1 UTSW 1 67214087 missense probably benign 0.03
R8819:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
R8820:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTCCAAATTTTGAGTTCAAGTGGC -3'
(R):5'- AGCTATCGCCCATAAATGTGTTC -3'

Sequencing Primer
(F):5'- CAAGTGGCTACTGTTAGTGCC -3'
(R):5'- AGGCTGGGATTCTGTCC -3'
Posted On2020-06-30