Incidental Mutation 'R8097:Usp8'
ID630222
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8097 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126754880 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 870 (N870S)
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028841
AA Change: N859S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: N859S

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110416
AA Change: N870S

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: N870S

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,816,955 M749I probably benign Het
Adgrb2 G A 4: 130,007,897 C438Y probably damaging Het
Atxn2 C T 5: 121,749,223 R319W probably damaging Het
Ccdc162 T C 10: 41,634,119 E830G probably benign Het
Ccdc71 T C 9: 108,463,552 V188A probably benign Het
Ceacam11 A T 7: 17,975,530 R218* probably null Het
Col18a1 A C 10: 77,112,508 L390R unknown Het
Cps1 A G 1: 67,228,270 N1399S probably benign Het
Ctnnal1 T C 4: 56,847,845 E98G probably damaging Het
Cyp2d11 C A 15: 82,390,380 probably null Het
Cyp2j7 G A 4: 96,215,410 T296I possibly damaging Het
Dcc C T 18: 71,679,502 G407D probably damaging Het
E330034G19Rik T C 14: 24,306,852 L217S unknown Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 A G 10: 96,026,654 K813E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etf1 T C 18: 34,931,644 D4G probably benign Het
F830045P16Rik T C 2: 129,463,585 T290A possibly damaging Het
Filip1 T C 9: 79,818,259 D1026G probably benign Het
Flad1 A T 3: 89,409,135 L40H probably damaging Het
Fpr3 C A 17: 17,970,792 N108K probably damaging Het
Gm30302 T A 13: 49,790,200 M1L probably benign Het
Hmgcll1 T C 9: 76,015,139 L22P probably benign Het
Iars2 C T 1: 185,329,389 probably benign Het
Ifna15 A T 4: 88,557,701 L182Q probably benign Het
Kcna6 A T 6: 126,738,612 V438E probably damaging Het
Kcnma1 T A 14: 23,330,964 D1012V probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 G A 10: 27,190,664 Q1074* probably null Het
Lhx9 T C 1: 138,838,351 Y242C probably damaging Het
Lrrc37a T A 11: 103,504,099 I167F probably benign Het
Lrrc56 A G 7: 141,195,906 probably null Het
Mlh1 C A 9: 111,256,092 probably null Het
Msh4 C T 3: 153,877,908 probably null Het
Nav2 A G 7: 49,587,777 D1999G probably damaging Het
Ncapd2 A T 6: 125,168,982 I1272K possibly damaging Het
Neurl1a A G 19: 47,257,519 D530G probably damaging Het
Nid2 T C 14: 19,798,589 V1019A possibly damaging Het
Nlrp2 A T 7: 5,327,651 L582Q probably damaging Het
Olfr1046 A T 2: 86,217,666 F15I probably damaging Het
Olfr1226 A T 2: 89,193,632 I134N probably damaging Het
Olfr33 A G 7: 102,713,990 V141A possibly damaging Het
Olfr99 A T 17: 37,279,927 Y164* probably null Het
Pde6c G T 19: 38,161,966 E520* probably null Het
Pdzk1 C T 3: 96,850,240 T4I probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rap1gap G T 4: 137,728,286 V667F probably benign Het
Recql A T 6: 142,374,911 I137N probably damaging Het
Ryr2 T C 13: 11,945,995 E19G probably damaging Het
Six1 A G 12: 73,043,750 S214P possibly damaging Het
Slc24a1 T C 9: 64,924,452 D1121G probably damaging Het
Slc30a6 T A 17: 74,412,698 C218S possibly damaging Het
Stab2 T C 10: 86,869,095 D1803G possibly damaging Het
Sult2a3 A T 7: 14,082,710 V181E possibly damaging Het
Ubc C T 5: 125,389,918 probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vps13b T C 15: 35,709,346 I1813T probably benign Het
Wdr11 C T 7: 129,607,887 P473L probably damaging Het
Zcchc4 T A 5: 52,795,991 I114N probably benign Het
Zfp516 C A 18: 82,987,170 S733* probably null Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R7768:Usp8 UTSW 2 126751123 missense probably damaging 1.00
R8130:Usp8 UTSW 2 126717998 intron probably benign
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGTCCTTTCAGTAAAGTG -3'
(R):5'- TACTTGTGGATGCTAGCGGC -3'

Sequencing Primer
(F):5'- CATGTCCTTTCAGTAAAGTGGGTTTG -3'
(R):5'- CAAAGACAAGTACATGAAGGCCTCG -3'
Posted On2020-06-30